Incidental Mutation 'R8846:Ighv1-53'
ID674715
Institutional Source Beutler Lab
Gene Symbol Ighv1-53
Ensembl Gene ENSMUSG00000093894
Gene Nameimmunoglobulin heavy variable 1-53
SynonymsAB069917, V23-D-J-C mu
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R8846 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location115158403-115158835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115158545 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 70 (I70S)
Ref Sequence ENSEMBL: ENSMUSP00000100304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103523]
Predicted Effect probably damaging
Transcript: ENSMUST00000103523
AA Change: I70S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100304
Gene: ENSMUSG00000093894
AA Change: I70S

DomainStartEndE-ValueType
IGv 36 117 3.52e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,605,884 I1198F possibly damaging Het
Adgrv1 C T 13: 81,488,906 probably null Het
Adprh T C 16: 38,447,413 H170R probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
B3galt1 A G 2: 68,118,373 D144G probably benign Het
Ccdc88a C T 11: 29,464,185 R908C probably damaging Het
Ccs A G 19: 4,833,452 L106P probably damaging Het
Dock10 T C 1: 80,568,069 D820G possibly damaging Het
Gda A G 19: 21,412,525 I298T probably damaging Het
Gm4858 A T 3: 93,074,463 I189F possibly damaging Het
Gpr84 A T 15: 103,309,610 H13Q possibly damaging Het
Igdcc4 T C 9: 65,130,616 S760P probably benign Het
Itpr3 T A 17: 27,112,022 I1768N probably damaging Het
Kctd13 C A 7: 126,945,019 D296E probably benign Het
Krt76 A G 15: 101,887,337 I466T probably damaging Het
Lamb1 T C 12: 31,329,389 Y1801H possibly damaging Het
Mapk10 A G 5: 102,996,655 F129L probably damaging Het
Myo5b G A 18: 74,707,972 E975K probably benign Het
Nrtn C T 17: 56,751,728 R91H possibly damaging Het
Olfml2a A T 2: 38,960,243 Y657F probably damaging Het
Olfr1426 T C 19: 12,088,069 H241R probably damaging Het
Olfr50 T A 2: 36,793,677 V147E probably benign Het
Pfkfb2 T C 1: 130,697,911 T511A probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 G T 15: 44,546,962 G2622* probably null Het
Ppp6r3 A T 19: 3,514,654 D206E probably damaging Het
Ptpn3 A G 4: 57,205,020 Y714H probably damaging Het
Rfng C A 11: 120,784,146 R6L unknown Het
Scrt1 A T 15: 76,521,608 V33E possibly damaging Het
Siglecg A T 7: 43,412,518 I563F probably benign Het
Slc1a6 G A 10: 78,801,947 A436T probably damaging Het
Slc38a9 C A 13: 112,723,280 S416* probably null Het
Sptbn1 A G 11: 30,125,009 S1288P possibly damaging Het
Tbce A G 13: 14,019,700 probably null Het
Topors A G 4: 40,262,952 F111L probably damaging Het
Vmn1r11 T C 6: 57,137,822 M157T probably benign Het
Wdfy4 A G 14: 33,145,148 L459P Het
Zfp738 T C 13: 67,670,036 N612S probably benign Het
Other mutations in Ighv1-53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01815:Ighv1-53 APN 12 115158597 missense probably benign 0.01
IGL02326:Ighv1-53 APN 12 115158615 missense probably benign 0.21
BB010:Ighv1-53 UTSW 12 115158409 nonsense probably null
BB020:Ighv1-53 UTSW 12 115158409 nonsense probably null
R3404:Ighv1-53 UTSW 12 115158438 missense possibly damaging 0.81
R4020:Ighv1-53 UTSW 12 115158822 missense probably benign 0.00
R4169:Ighv1-53 UTSW 12 115158546 missense possibly damaging 0.63
R4241:Ighv1-53 UTSW 12 115158822 missense probably benign 0.00
R5231:Ighv1-53 UTSW 12 115158605 missense probably benign 0.09
R7139:Ighv1-53 UTSW 12 115158821 nonsense probably null
R7220:Ighv1-53 UTSW 12 115158515 missense probably benign 0.00
R7293:Ighv1-53 UTSW 12 115158821 nonsense probably null
R7933:Ighv1-53 UTSW 12 115158409 nonsense probably null
R7934:Ighv1-53 UTSW 12 115158616 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTTGCTACTCATCCAGG -3'
(R):5'- GGTGACAATGACATCCACTTTGC -3'

Sequencing Primer
(F):5'- CAGGGTTTCTGACACTCTCAGG -3'
(R):5'- GACAATGACATCCACTTTGCCTTTC -3'
Posted On2021-07-15