Incidental Mutation 'R8846:Krt76'
ID 674723
Institutional Source Beutler Lab
Gene Symbol Krt76
Ensembl Gene ENSMUSG00000075402
Gene Name keratin 76
Synonyms 2310001L23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8846 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101884351-101892920 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101887337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 466 (I466T)
Ref Sequence ENSEMBL: ENSMUSP00000097754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100179]
AlphaFold Q3UV17
Predicted Effect probably damaging
Transcript: ENSMUST00000100179
AA Change: I466T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: I466T

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 161 5.7e-39 PFAM
Filament 164 479 2.12e-166 SMART
low complexity region 488 551 N/A INTRINSIC
low complexity region 565 593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,605,884 I1198F possibly damaging Het
Adgrv1 C T 13: 81,488,906 probably null Het
Adprh T C 16: 38,447,413 H170R probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
B3galt1 A G 2: 68,118,373 D144G probably benign Het
Ccdc88a C T 11: 29,464,185 R908C probably damaging Het
Ccs A G 19: 4,833,452 L106P probably damaging Het
Dock10 T C 1: 80,568,069 D820G possibly damaging Het
Gda A G 19: 21,412,525 I298T probably damaging Het
Gm4858 A T 3: 93,074,463 I189F possibly damaging Het
Gpr84 A T 15: 103,309,610 H13Q possibly damaging Het
Igdcc4 T C 9: 65,130,616 S760P probably benign Het
Ighv1-53 A C 12: 115,158,545 I70S probably damaging Het
Itpr3 T A 17: 27,112,022 I1768N probably damaging Het
Kctd13 C A 7: 126,945,019 D296E probably benign Het
Lamb1 T C 12: 31,329,389 Y1801H possibly damaging Het
Mapk10 A G 5: 102,996,655 F129L probably damaging Het
Myo5b G A 18: 74,707,972 E975K probably benign Het
Nrtn C T 17: 56,751,728 R91H possibly damaging Het
Olfml2a A T 2: 38,960,243 Y657F probably damaging Het
Olfr1426 T C 19: 12,088,069 H241R probably damaging Het
Olfr50 T A 2: 36,793,677 V147E probably benign Het
Pfkfb2 T C 1: 130,697,911 T511A probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 G T 15: 44,546,962 G2622* probably null Het
Ppp6r3 A T 19: 3,514,654 D206E probably damaging Het
Ptpn3 A G 4: 57,205,020 Y714H probably damaging Het
Rfng C A 11: 120,784,146 R6L unknown Het
Scrt1 A T 15: 76,521,608 V33E possibly damaging Het
Siglecg A T 7: 43,412,518 I563F probably benign Het
Slc1a6 G A 10: 78,801,947 A436T probably damaging Het
Slc38a9 C A 13: 112,723,280 S416* probably null Het
Sptbn1 A G 11: 30,125,009 S1288P possibly damaging Het
Tbce A G 13: 14,019,700 probably null Het
Topors A G 4: 40,262,952 F111L probably damaging Het
Vmn1r11 T C 6: 57,137,822 M157T probably benign Het
Wdfy4 A G 14: 33,145,148 L459P Het
Zfp738 T C 13: 67,670,036 N612S probably benign Het
Other mutations in Krt76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Krt76 APN 15 101884888 missense unknown
IGL01475:Krt76 APN 15 101888513 missense probably benign 0.11
IGL01504:Krt76 APN 15 101888173 missense probably damaging 1.00
IGL01506:Krt76 APN 15 101892400 missense probably damaging 0.97
IGL01943:Krt76 APN 15 101889045 missense probably null 0.98
IGL03164:Krt76 APN 15 101887451 missense possibly damaging 0.50
PIT4378001:Krt76 UTSW 15 101892407 missense probably damaging 0.99
R0105:Krt76 UTSW 15 101884912 missense unknown
R0105:Krt76 UTSW 15 101884912 missense unknown
R0448:Krt76 UTSW 15 101890647 missense probably damaging 1.00
R0730:Krt76 UTSW 15 101887349 missense probably damaging 1.00
R0920:Krt76 UTSW 15 101892439 missense possibly damaging 0.80
R1568:Krt76 UTSW 15 101885008 missense unknown
R1779:Krt76 UTSW 15 101892687 missense unknown
R1869:Krt76 UTSW 15 101889487 critical splice donor site probably null
R1911:Krt76 UTSW 15 101888165 nonsense probably null
R2160:Krt76 UTSW 15 101888385 missense probably damaging 1.00
R2504:Krt76 UTSW 15 101884858 missense unknown
R4487:Krt76 UTSW 15 101890482 missense possibly damaging 0.71
R4729:Krt76 UTSW 15 101889081 missense probably damaging 1.00
R4747:Krt76 UTSW 15 101885745 missense probably damaging 1.00
R4912:Krt76 UTSW 15 101888162 nonsense probably null
R5357:Krt76 UTSW 15 101887385 missense probably benign 0.04
R6738:Krt76 UTSW 15 101887478 missense probably benign 0.40
R7786:Krt76 UTSW 15 101890530 missense probably damaging 0.98
R7808:Krt76 UTSW 15 101890494 missense probably damaging 1.00
R7825:Krt76 UTSW 15 101887503 missense possibly damaging 0.46
R8079:Krt76 UTSW 15 101888390 missense possibly damaging 0.61
R8980:Krt76 UTSW 15 101892555 missense unknown
Z1088:Krt76 UTSW 15 101890551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGACTTAATCGCTTCCTCTG -3'
(R):5'- CTTCCTGTGAATCATCCGGTG -3'

Sequencing Primer
(F):5'- GCTGCTGTCTCTCCAACCTG -3'
(R):5'- CCGGTGTTTGTGTAGTAGACCTATAC -3'
Posted On 2021-07-15