Incidental Mutation 'R8846:Adprh'
ID 674725
Institutional Source Beutler Lab
Gene Symbol Adprh
Ensembl Gene ENSMUSG00000002844
Gene Name ADP-ribosylarginine hydrolase
Synonyms Arh1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock # R8846 (G1)
Quality Score 210.009
Status Not validated
Chromosome 16
Chromosomal Location 38444030-38452703 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38447413 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 170 (H170R)
Ref Sequence ENSEMBL: ENSMUSP00000002923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002923]
AlphaFold P54923
Predicted Effect probably damaging
Transcript: ENSMUST00000002923
AA Change: H170R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002923
Gene: ENSMUSG00000002844
AA Change: H170R

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 11 331 1.1e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes removal of mono-ADP-ribose from arginine residues of proteins in the ADP-ribosylation cycle. Unlike the rat and mouse enzymes that require DTT for maximal activity, the human enzyme is DTT-independent. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to the effects of cholera toxin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,605,884 I1198F possibly damaging Het
Adgrv1 C T 13: 81,488,906 probably null Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
B3galt1 A G 2: 68,118,373 D144G probably benign Het
Ccdc88a C T 11: 29,464,185 R908C probably damaging Het
Ccs A G 19: 4,833,452 L106P probably damaging Het
Dock10 T C 1: 80,568,069 D820G possibly damaging Het
Gda A G 19: 21,412,525 I298T probably damaging Het
Gm4858 A T 3: 93,074,463 I189F possibly damaging Het
Gpr84 A T 15: 103,309,610 H13Q possibly damaging Het
Igdcc4 T C 9: 65,130,616 S760P probably benign Het
Ighv1-53 A C 12: 115,158,545 I70S probably damaging Het
Itpr3 T A 17: 27,112,022 I1768N probably damaging Het
Kctd13 C A 7: 126,945,019 D296E probably benign Het
Krt76 A G 15: 101,887,337 I466T probably damaging Het
Lamb1 T C 12: 31,329,389 Y1801H possibly damaging Het
Mapk10 A G 5: 102,996,655 F129L probably damaging Het
Myo5b G A 18: 74,707,972 E975K probably benign Het
Nrtn C T 17: 56,751,728 R91H possibly damaging Het
Olfml2a A T 2: 38,960,243 Y657F probably damaging Het
Olfr1426 T C 19: 12,088,069 H241R probably damaging Het
Olfr50 T A 2: 36,793,677 V147E probably benign Het
Pfkfb2 T C 1: 130,697,911 T511A probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 G T 15: 44,546,962 G2622* probably null Het
Ppp6r3 A T 19: 3,514,654 D206E probably damaging Het
Ptpn3 A G 4: 57,205,020 Y714H probably damaging Het
Rfng C A 11: 120,784,146 R6L unknown Het
Scrt1 A T 15: 76,521,608 V33E possibly damaging Het
Siglecg A T 7: 43,412,518 I563F probably benign Het
Slc1a6 G A 10: 78,801,947 A436T probably damaging Het
Slc38a9 C A 13: 112,723,280 S416* probably null Het
Sptbn1 A G 11: 30,125,009 S1288P possibly damaging Het
Tbce A G 13: 14,019,700 probably null Het
Topors A G 4: 40,262,952 F111L probably damaging Het
Vmn1r11 T C 6: 57,137,822 M157T probably benign Het
Wdfy4 A G 14: 33,145,148 L459P Het
Zfp738 T C 13: 67,670,036 N612S probably benign Het
Other mutations in Adprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Adprh APN 16 38450216 missense possibly damaging 0.65
IGL02012:Adprh APN 16 38445852 missense possibly damaging 0.92
IGL02182:Adprh APN 16 38447476 missense probably benign
IGL02862:Adprh APN 16 38446034 missense probably benign
IGL02884:Adprh APN 16 38446034 missense probably benign
IGL03065:Adprh APN 16 38446034 missense probably benign
R0829:Adprh UTSW 16 38445788 missense probably benign
R1164:Adprh UTSW 16 38450340 missense probably benign
R1542:Adprh UTSW 16 38445924 missense probably damaging 0.99
R4591:Adprh UTSW 16 38445983 missense probably benign
R4965:Adprh UTSW 16 38445780 nonsense probably null
R5271:Adprh UTSW 16 38446054 nonsense probably null
R5928:Adprh UTSW 16 38447384 missense probably benign
R6383:Adprh UTSW 16 38447452 missense probably damaging 1.00
R6469:Adprh UTSW 16 38450309 missense probably benign 0.00
R6526:Adprh UTSW 16 38447276 missense probably benign 0.00
R6978:Adprh UTSW 16 38445809 missense probably damaging 1.00
R8143:Adprh UTSW 16 38450332 missense probably benign 0.02
R8437:Adprh UTSW 16 38446087 missense probably benign 0.03
R8482:Adprh UTSW 16 38447509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCCACAAGTCAGCTAGG -3'
(R):5'- GTGGTGCTTGCATGCAGAAC -3'

Sequencing Primer
(F):5'- GTCAGCTAGGACACACACCCAG -3'
(R):5'- TTGCATGCAGAACGCCATG -3'
Posted On 2021-07-15