Incidental Mutation 'R8847:Olfr1333'
ID 674743
Institutional Source Beutler Lab
Gene Symbol Olfr1333
Ensembl Gene ENSMUSG00000110947
Gene Name olfactory receptor 1333
Synonyms MOR259-11, GA_x6K02T2QD9B-18703033-18703986, MOR259-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R8847 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118827659-118836279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118829624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000154759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076019] [ENSMUST00000214477]
AlphaFold Q7TQV7
Predicted Effect probably damaging
Transcript: ENSMUST00000076019
AA Change: D272G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075398
Gene: ENSMUSG00000110947
AA Change: D272G

DomainStartEndE-ValueType
Pfam:7tm_1 42 291 4.1e-31 PFAM
Pfam:7tm_4 140 284 2.9e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: D271G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: D271G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,753,709 R4T probably benign Het
Alk T A 17: 71,949,825 I680F probably benign Het
Best3 A G 10: 116,988,667 T13A possibly damaging Het
Ccdc7b A G 8: 129,145,601 D59G Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cic G A 7: 25,271,206 V121M probably damaging Het
Clasp1 C G 1: 118,578,975 P1280R probably damaging Het
Col6a5 A T 9: 105,864,273 N2482K possibly damaging Het
Crebbp A G 16: 4,085,027 M2116T probably benign Het
Ddn T C 15: 98,806,913 E166G possibly damaging Het
Dennd6a C T 14: 26,605,931 T249I probably benign Het
Diaph1 A T 18: 37,854,537 D1055E possibly damaging Het
Dnajc13 C A 9: 104,180,161 G1547* probably null Het
Dvl1 C T 4: 155,858,154 R626C possibly damaging Het
Fam126b G T 1: 58,556,554 P55Q probably damaging Het
Fam129a A G 1: 151,700,178 E351G probably damaging Het
Fer1l6 A C 15: 58,542,163 K13Q possibly damaging Het
Fry G A 5: 150,386,007 E639K Het
Gm6408 G T 5: 146,483,792 V161L probably benign Het
Gpatch8 A T 11: 102,481,184 N509K unknown Het
Ints13 T C 6: 146,556,133 T416A probably benign Het
Iqcf6 A T 9: 106,627,451 M105L probably damaging Het
Magi3 C A 3: 104,015,018 R1461L probably benign Het
Map3k8 A T 18: 4,333,889 L401Q Het
Miga2 G T 2: 30,383,978 R542L probably damaging Het
Mphosph9 A T 5: 124,316,146 V96E possibly damaging Het
Nek5 T C 8: 22,123,579 S28G probably benign Het
Notch4 A G 17: 34,584,988 probably benign Het
Npc1 A G 18: 12,190,930 L1275P probably damaging Het
Nphp4 C T 4: 152,506,406 R287C probably damaging Het
Olfr341 G A 2: 36,479,471 R220* probably null Het
Olfr406 C T 11: 74,269,617 T76I probably damaging Het
Olfr53 G C 7: 140,652,413 A145P possibly damaging Het
Parn A T 16: 13,628,406 L343* probably null Het
Pax5 T A 4: 44,691,865 D127V probably benign Het
Peak1 C A 9: 56,207,143 D1505Y probably damaging Het
Perm1 C T 4: 156,217,611 T204I probably benign Het
Pid1 A T 1: 84,115,973 S65T unknown Het
Pkn2 A G 3: 142,820,640 V392A probably benign Het
Plekhh2 A G 17: 84,571,051 D578G probably benign Het
Ppp4r4 T A 12: 103,596,488 L572Q probably damaging Het
Pum3 G A 19: 27,421,313 T279M probably damaging Het
Rasa2 A G 9: 96,576,349 V266A possibly damaging Het
Sirpb1c C T 3: 15,832,420 W264* probably null Het
Slc35g3 A T 11: 69,760,573 Y195* probably null Het
Slk T A 19: 47,619,193 H289Q Het
Spef2 T C 15: 9,668,827 S758G probably benign Het
Spon2 C T 5: 33,214,497 A322T probably benign Het
Spred2 T C 11: 20,001,064 L87P probably benign Het
Stk10 A G 11: 32,589,427 D269G Het
Tex48 T A 4: 63,612,535 probably benign Het
Themis2 T A 4: 132,786,198 H239L probably damaging Het
Tle4 T A 19: 14,516,373 R199* probably null Het
Tlr11 C T 14: 50,362,725 H723Y possibly damaging Het
Trdj2 T A 14: 54,136,780 S1T Het
Vdac1 T G 11: 52,376,403 S44A Het
Vill C T 9: 119,068,446 T647I probably damaging Het
Vmn1r61 A G 7: 5,610,818 C166R probably damaging Het
Vmn2r114 T A 17: 23,310,012 N372I probably damaging Het
Vmn2r120 T A 17: 57,509,217 M713L probably benign Het
Vmn2r61 T C 7: 42,300,586 V810A probably damaging Het
Vmn2r65 A T 7: 84,941,004 L568Q probably damaging Het
Wdr7 T C 18: 63,739,222 V409A probably damaging Het
Ylpm1 C A 12: 85,014,898 N524K unknown Het
Zfp958 A C 8: 4,628,434 H153P probably damaging Het
Other mutations in Olfr1333
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1333 APN 4 118829792 missense probably benign 0.30
IGL03023:Olfr1333 APN 4 118830252 missense probably damaging 0.99
IGL03387:Olfr1333 APN 4 118830041 missense probably damaging 1.00
R0326:Olfr1333 UTSW 4 118829825 missense possibly damaging 0.90
R0532:Olfr1333 UTSW 4 118829700 missense probably damaging 1.00
R1775:Olfr1333 UTSW 4 118829868 missense probably benign 0.00
R1906:Olfr1333 UTSW 4 118830270 missense probably damaging 1.00
R1946:Olfr1333 UTSW 4 118830026 missense probably benign 0.00
R2260:Olfr1333 UTSW 4 118830162 missense probably damaging 1.00
R5084:Olfr1333 UTSW 4 118829570 missense probably damaging 1.00
R5337:Olfr1333 UTSW 4 118829666 missense probably benign 0.44
R5444:Olfr1333 UTSW 4 118830111 missense probably benign
R5817:Olfr1333 UTSW 4 118830099 missense probably damaging 0.96
R5973:Olfr1333 UTSW 4 118830216 missense probably benign 0.22
R5987:Olfr1333 UTSW 4 118830281 missense probably damaging 0.96
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R7255:Olfr1333 UTSW 4 118829952 missense probably benign 0.17
R7483:Olfr1333 UTSW 4 118830320 missense probably damaging 0.98
R8214:Olfr1333 UTSW 4 118830091 missense probably benign
R8479:Olfr1333 UTSW 4 118830015 missense probably damaging 1.00
Z1176:Olfr1333 UTSW 4 118830050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATGCTGTCTTTCAGGAATG -3'
(R):5'- GTGGCCTCCTACATTCGTATTG -3'

Sequencing Primer
(F):5'- GCACTGTTTCAGTATTAGGCAAAG -3'
(R):5'- GCCATGGCAATTCTCAAGATC -3'
Posted On 2021-07-15