Incidental Mutation 'R8847:Or10ak11'
ID 674743
Institutional Source Beutler Lab
Gene Symbol Or10ak11
Ensembl Gene ENSMUSG00000110947
Gene Name olfactory receptor family 10 subfamily AK member 11
Synonyms Olfr1333, MOR259-6, MOR259-11, GA_x6K02T2QD9B-18703033-18703986
MMRRC Submission 068735-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R8847 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118686682-118687635 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118686821 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000154759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076019] [ENSMUST00000214477]
AlphaFold Q7TQV7
Predicted Effect probably damaging
Transcript: ENSMUST00000076019
AA Change: D272G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075398
Gene: ENSMUSG00000110947
AA Change: D272G

DomainStartEndE-ValueType
Pfam:7tm_1 42 291 4.1e-31 PFAM
Pfam:7tm_4 140 284 2.9e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: D271G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: D271G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 41,206,746 (GRCm39) R4T probably benign Het
Alk T A 17: 72,256,820 (GRCm39) I680F probably benign Het
Best3 A G 10: 116,824,572 (GRCm39) T13A possibly damaging Het
Ccdc7b A G 8: 129,872,082 (GRCm39) D59G Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 114,903,257 (GRCm39) probably benign Het
Cic G A 7: 24,970,631 (GRCm39) V121M probably damaging Het
Clasp1 C G 1: 118,506,705 (GRCm39) P1280R probably damaging Het
Col6a5 A T 9: 105,741,472 (GRCm39) N2482K possibly damaging Het
Crebbp A G 16: 3,902,891 (GRCm39) M2116T probably benign Het
Ddn T C 15: 98,704,794 (GRCm39) E166G possibly damaging Het
Dennd6a C T 14: 26,327,086 (GRCm39) T249I probably benign Het
Diaph1 A T 18: 37,987,590 (GRCm39) D1055E possibly damaging Het
Dnajc13 C A 9: 104,057,360 (GRCm39) G1547* probably null Het
Dvl1 C T 4: 155,942,611 (GRCm39) R626C possibly damaging Het
Fer1l6 A C 15: 58,414,012 (GRCm39) K13Q possibly damaging Het
Fry G A 5: 150,309,472 (GRCm39) E639K Het
Gm6408 G T 5: 146,420,602 (GRCm39) V161L probably benign Het
Gpatch8 A T 11: 102,372,010 (GRCm39) N509K unknown Het
Hycc2 G T 1: 58,595,713 (GRCm39) P55Q probably damaging Het
Ints13 T C 6: 146,457,631 (GRCm39) T416A probably benign Het
Iqcf6 A T 9: 106,504,650 (GRCm39) M105L probably damaging Het
Magi3 C A 3: 103,922,334 (GRCm39) R1461L probably benign Het
Map3k8 A T 18: 4,333,889 (GRCm39) L401Q Het
Miga2 G T 2: 30,273,990 (GRCm39) R542L probably damaging Het
Mphosph9 A T 5: 124,454,209 (GRCm39) V96E possibly damaging Het
Nek5 T C 8: 22,613,595 (GRCm39) S28G probably benign Het
Niban1 A G 1: 151,575,929 (GRCm39) E351G probably damaging Het
Notch4 A G 17: 34,803,962 (GRCm39) probably benign Het
Npc1 A G 18: 12,323,987 (GRCm39) L1275P probably damaging Het
Nphp4 C T 4: 152,590,863 (GRCm39) R287C probably damaging Het
Or13a20 G C 7: 140,232,326 (GRCm39) A145P possibly damaging Het
Or1j13 G A 2: 36,369,483 (GRCm39) R220* probably null Het
Or1p1c C T 11: 74,160,443 (GRCm39) T76I probably damaging Het
Parn A T 16: 13,446,270 (GRCm39) L343* probably null Het
Pax5 T A 4: 44,691,865 (GRCm39) D127V probably benign Het
Peak1 C A 9: 56,114,427 (GRCm39) D1505Y probably damaging Het
Perm1 C T 4: 156,302,068 (GRCm39) T204I probably benign Het
Pid1 A T 1: 84,093,694 (GRCm39) S65T unknown Het
Pkn2 A G 3: 142,526,401 (GRCm39) V392A probably benign Het
Plekhh2 A G 17: 84,878,479 (GRCm39) D578G probably benign Het
Ppp4r4 T A 12: 103,562,747 (GRCm39) L572Q probably damaging Het
Pum3 G A 19: 27,398,713 (GRCm39) T279M probably damaging Het
Rasa2 A G 9: 96,458,402 (GRCm39) V266A possibly damaging Het
Sirpb1c C T 3: 15,886,584 (GRCm39) W264* probably null Het
Slc35g3 A T 11: 69,651,399 (GRCm39) Y195* probably null Het
Slk T A 19: 47,607,632 (GRCm39) H289Q Het
Spef2 T C 15: 9,668,913 (GRCm39) S758G probably benign Het
Spon2 C T 5: 33,371,841 (GRCm39) A322T probably benign Het
Spred2 T C 11: 19,951,064 (GRCm39) L87P probably benign Het
Stk10 A G 11: 32,539,427 (GRCm39) D269G Het
Tex48 T A 4: 63,530,772 (GRCm39) probably benign Het
Themis2 T A 4: 132,513,509 (GRCm39) H239L probably damaging Het
Tle4 T A 19: 14,493,737 (GRCm39) R199* probably null Het
Tlr11 C T 14: 50,600,182 (GRCm39) H723Y possibly damaging Het
Trdj2 T A 14: 54,374,237 (GRCm39) S1T Het
Vdac1 T G 11: 52,267,230 (GRCm39) S44A Het
Vill C T 9: 118,897,514 (GRCm39) T647I probably damaging Het
Vmn1r61 A G 7: 5,613,817 (GRCm39) C166R probably damaging Het
Vmn2r114 T A 17: 23,528,986 (GRCm39) N372I probably damaging Het
Vmn2r120 T A 17: 57,816,217 (GRCm39) M713L probably benign Het
Vmn2r61 T C 7: 41,950,010 (GRCm39) V810A probably damaging Het
Vmn2r65 A T 7: 84,590,212 (GRCm39) L568Q probably damaging Het
Wdr7 T C 18: 63,872,293 (GRCm39) V409A probably damaging Het
Ylpm1 C A 12: 85,061,672 (GRCm39) N524K unknown Het
Zfp958 A C 8: 4,678,434 (GRCm39) H153P probably damaging Het
Other mutations in Or10ak11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Or10ak11 APN 4 118,686,989 (GRCm39) missense probably benign 0.30
IGL03023:Or10ak11 APN 4 118,687,449 (GRCm39) missense probably damaging 0.99
IGL03387:Or10ak11 APN 4 118,687,238 (GRCm39) missense probably damaging 1.00
R0326:Or10ak11 UTSW 4 118,687,022 (GRCm39) missense possibly damaging 0.90
R0532:Or10ak11 UTSW 4 118,686,897 (GRCm39) missense probably damaging 1.00
R1775:Or10ak11 UTSW 4 118,687,065 (GRCm39) missense probably benign 0.00
R1906:Or10ak11 UTSW 4 118,687,467 (GRCm39) missense probably damaging 1.00
R1946:Or10ak11 UTSW 4 118,687,223 (GRCm39) missense probably benign 0.00
R2260:Or10ak11 UTSW 4 118,687,359 (GRCm39) missense probably damaging 1.00
R5084:Or10ak11 UTSW 4 118,686,767 (GRCm39) missense probably damaging 1.00
R5337:Or10ak11 UTSW 4 118,686,863 (GRCm39) missense probably benign 0.44
R5444:Or10ak11 UTSW 4 118,687,308 (GRCm39) missense probably benign
R5817:Or10ak11 UTSW 4 118,687,296 (GRCm39) missense probably damaging 0.96
R5973:Or10ak11 UTSW 4 118,687,413 (GRCm39) missense probably benign 0.22
R5987:Or10ak11 UTSW 4 118,687,478 (GRCm39) missense probably damaging 0.96
R6031:Or10ak11 UTSW 4 118,687,588 (GRCm39) splice site probably null
R6031:Or10ak11 UTSW 4 118,687,588 (GRCm39) splice site probably null
R7255:Or10ak11 UTSW 4 118,687,149 (GRCm39) missense probably benign 0.17
R7483:Or10ak11 UTSW 4 118,687,517 (GRCm39) missense probably damaging 0.98
R8214:Or10ak11 UTSW 4 118,687,288 (GRCm39) missense probably benign
R8479:Or10ak11 UTSW 4 118,687,212 (GRCm39) missense probably damaging 1.00
R9661:Or10ak11 UTSW 4 118,687,526 (GRCm39) missense probably benign 0.45
Z1176:Or10ak11 UTSW 4 118,687,247 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATGCTGTCTTTCAGGAATG -3'
(R):5'- GTGGCCTCCTACATTCGTATTG -3'

Sequencing Primer
(F):5'- GCACTGTTTCAGTATTAGGCAAAG -3'
(R):5'- GCCATGGCAATTCTCAAGATC -3'
Posted On 2021-07-15