Incidental Mutation 'R8847:Nek5'
ID674759
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
Synonyms
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8847 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22123579 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 28 (S28G)
Ref Sequence ENSEMBL: ENSMUSP00000148211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033865] [ENSMUST00000110730] [ENSMUST00000169834] [ENSMUST00000178324] [ENSMUST00000209656]
Predicted Effect probably benign
Transcript: ENSMUST00000033865
SMART Domains Protein: ENSMUSP00000033865
Gene: ENSMUSG00000031478

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 444 8e-49 BLAST
low complexity region 471 485 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110730
SMART Domains Protein: ENSMUSP00000106358
Gene: ENSMUSG00000031478

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169834
AA Change: S28G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738
AA Change: S28G

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000178324
SMART Domains Protein: ENSMUSP00000136876
Gene: ENSMUSG00000031478

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209656
AA Change: S28G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000210824
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,753,709 R4T probably benign Het
Alk T A 17: 71,949,825 I680F probably benign Het
Best3 A G 10: 116,988,667 T13A possibly damaging Het
Ccdc7b A G 8: 129,145,601 D59G Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cic G A 7: 25,271,206 V121M probably damaging Het
Col6a5 A T 9: 105,864,273 N2482K possibly damaging Het
Crebbp A G 16: 4,085,027 M2116T probably benign Het
Ddn T C 15: 98,806,913 E166G possibly damaging Het
Dennd6a C T 14: 26,605,931 T249I probably benign Het
Diaph1 A T 18: 37,854,537 D1055E possibly damaging Het
Dnajc13 C A 9: 104,180,161 G1547* probably null Het
Dvl1 C T 4: 155,858,154 R626C possibly damaging Het
Fam129a A G 1: 151,700,178 E351G probably damaging Het
Fer1l6 A C 15: 58,542,163 K13Q possibly damaging Het
Fry G A 5: 150,386,007 E639K Het
Gm6408 G T 5: 146,483,792 V161L probably benign Het
Gpatch8 A T 11: 102,481,184 N509K unknown Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Ints13 T C 6: 146,556,133 T416A probably benign Het
Iqcf6 A T 9: 106,627,451 M105L probably damaging Het
Magi3 C A 3: 104,015,018 R1461L probably benign Het
Map3k8 A T 18: 4,333,889 L401Q Het
Miga2 G T 2: 30,383,978 R542L probably damaging Het
Mphosph9 A T 5: 124,316,146 V96E possibly damaging Het
Npc1 A G 18: 12,190,930 L1275P probably damaging Het
Nphp4 C T 4: 152,506,406 R287C probably damaging Het
Olfr1333 T C 4: 118,829,624 D271G probably damaging Het
Olfr341 G A 2: 36,479,471 R220* probably null Het
Olfr406 C T 11: 74,269,617 T76I probably damaging Het
Olfr53 G C 7: 140,652,413 A145P possibly damaging Het
Parn A T 16: 13,628,406 L343* probably null Het
Pax5 T A 4: 44,691,865 D127V probably benign Het
Peak1 C A 9: 56,207,143 D1505Y probably damaging Het
Perm1 C T 4: 156,217,611 T204I probably benign Het
Pid1 A T 1: 84,115,973 S65T unknown Het
Pkn2 A G 3: 142,820,640 V392A probably benign Het
Plekhh2 A G 17: 84,571,051 D578G probably benign Het
Ppp4r4 T A 12: 103,596,488 L572Q probably damaging Het
Pum3 G A 19: 27,421,313 T279M probably damaging Het
Rasa2 A G 9: 96,576,349 V266A possibly damaging Het
Sirpb1c C T 3: 15,832,420 W264* probably null Het
Slc35g3 A T 11: 69,760,573 Y195* probably null Het
Slk T A 19: 47,619,193 H289Q Het
Spef2 T C 15: 9,668,827 S758G probably benign Het
Spon2 C T 5: 33,214,497 A322T probably benign Het
Spred2 T C 11: 20,001,064 L87P probably benign Het
Stk10 A G 11: 32,589,427 D269G Het
Tex48 T A 4: 63,612,535 probably benign Het
Themis2 T A 4: 132,786,198 H239L probably damaging Het
Tle4 T A 19: 14,516,373 R199* probably null Het
Tlr11 C T 14: 50,362,725 H723Y possibly damaging Het
Trdj2 T A 14: 54,136,780 S1T Het
Vdac1 T G 11: 52,376,403 S44A Het
Vill C T 9: 119,068,446 T647I probably damaging Het
Vmn1r61 A G 7: 5,610,818 C166R probably damaging Het
Vmn2r114 T A 17: 23,310,012 N372I probably damaging Het
Vmn2r120 T A 17: 57,509,217 M713L probably benign Het
Vmn2r61 T C 7: 42,300,586 V810A probably damaging Het
Vmn2r65 A T 7: 84,941,004 L568Q probably damaging Het
Wdr7 T C 18: 63,739,222 V409A probably damaging Het
Ylpm1 C A 12: 85,014,898 N524K unknown Het
Zfp958 A C 8: 4,628,434 H153P probably damaging Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0522:Nek5 UTSW 8 22088797 splice site probably benign
R0525:Nek5 UTSW 8 22079077 unclassified probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4116:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5816:Nek5 UTSW 8 22096736 missense probably benign 0.02
R5884:Nek5 UTSW 8 22088801 critical splice donor site probably null
R6009:Nek5 UTSW 8 22120822 missense probably benign 0.00
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6300:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense probably benign 0.21
R8350:Nek5 UTSW 8 22113672 missense probably damaging 0.98
R8888:Nek5 UTSW 8 22090479 critical splice donor site probably null
R8933:Nek5 UTSW 8 22111210 missense probably damaging 1.00
R8933:Nek5 UTSW 8 22120843 missense probably damaging 1.00
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGAACCTGAAAATGCACAACTG -3'
(R):5'- ACGCTGGGTGGAAAGTTTTAAC -3'

Sequencing Primer
(F):5'- AAGGCCTAGGTTCAGTTCTTAGCAC -3'
(R):5'- GGTGGAAAGTTTTAACAAACAGCTCC -3'
Posted On2021-07-15