Incidental Mutation 'R8847:Dnajc13'
ID 674764
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene Name DnaJ heat shock protein family (Hsp40) member C13
Synonyms LOC382100, D030002L11Rik, Rme8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R8847 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 104151282-104262930 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 104180161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 1547 (G1547*)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
AlphaFold D4AFX7
Predicted Effect probably null
Transcript: ENSMUST00000035170
AA Change: G1542*
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: G1542*

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186788
AA Change: G1547*
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: G1547*

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,753,709 R4T probably benign Het
Alk T A 17: 71,949,825 I680F probably benign Het
Best3 A G 10: 116,988,667 T13A possibly damaging Het
Ccdc7b A G 8: 129,145,601 D59G Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cic G A 7: 25,271,206 V121M probably damaging Het
Clasp1 C G 1: 118,578,975 P1280R probably damaging Het
Col6a5 A T 9: 105,864,273 N2482K possibly damaging Het
Crebbp A G 16: 4,085,027 M2116T probably benign Het
Ddn T C 15: 98,806,913 E166G possibly damaging Het
Dennd6a C T 14: 26,605,931 T249I probably benign Het
Diaph1 A T 18: 37,854,537 D1055E possibly damaging Het
Dvl1 C T 4: 155,858,154 R626C possibly damaging Het
Fam126b G T 1: 58,556,554 P55Q probably damaging Het
Fam129a A G 1: 151,700,178 E351G probably damaging Het
Fer1l6 A C 15: 58,542,163 K13Q possibly damaging Het
Fry G A 5: 150,386,007 E639K Het
Gm6408 G T 5: 146,483,792 V161L probably benign Het
Gpatch8 A T 11: 102,481,184 N509K unknown Het
Ints13 T C 6: 146,556,133 T416A probably benign Het
Iqcf6 A T 9: 106,627,451 M105L probably damaging Het
Magi3 C A 3: 104,015,018 R1461L probably benign Het
Map3k8 A T 18: 4,333,889 L401Q Het
Miga2 G T 2: 30,383,978 R542L probably damaging Het
Mphosph9 A T 5: 124,316,146 V96E possibly damaging Het
Nek5 T C 8: 22,123,579 S28G probably benign Het
Notch4 A G 17: 34,584,988 probably benign Het
Npc1 A G 18: 12,190,930 L1275P probably damaging Het
Nphp4 C T 4: 152,506,406 R287C probably damaging Het
Olfr1333 T C 4: 118,829,624 D271G probably damaging Het
Olfr341 G A 2: 36,479,471 R220* probably null Het
Olfr406 C T 11: 74,269,617 T76I probably damaging Het
Olfr53 G C 7: 140,652,413 A145P possibly damaging Het
Parn A T 16: 13,628,406 L343* probably null Het
Pax5 T A 4: 44,691,865 D127V probably benign Het
Peak1 C A 9: 56,207,143 D1505Y probably damaging Het
Perm1 C T 4: 156,217,611 T204I probably benign Het
Pid1 A T 1: 84,115,973 S65T unknown Het
Pkn2 A G 3: 142,820,640 V392A probably benign Het
Plekhh2 A G 17: 84,571,051 D578G probably benign Het
Ppp4r4 T A 12: 103,596,488 L572Q probably damaging Het
Pum3 G A 19: 27,421,313 T279M probably damaging Het
Rasa2 A G 9: 96,576,349 V266A possibly damaging Het
Sirpb1c C T 3: 15,832,420 W264* probably null Het
Slc35g3 A T 11: 69,760,573 Y195* probably null Het
Slk T A 19: 47,619,193 H289Q Het
Spef2 T C 15: 9,668,827 S758G probably benign Het
Spon2 C T 5: 33,214,497 A322T probably benign Het
Spred2 T C 11: 20,001,064 L87P probably benign Het
Stk10 A G 11: 32,589,427 D269G Het
Tex48 T A 4: 63,612,535 probably benign Het
Themis2 T A 4: 132,786,198 H239L probably damaging Het
Tle4 T A 19: 14,516,373 R199* probably null Het
Tlr11 C T 14: 50,362,725 H723Y possibly damaging Het
Trdj2 T A 14: 54,136,780 S1T Het
Vdac1 T G 11: 52,376,403 S44A Het
Vill C T 9: 119,068,446 T647I probably damaging Het
Vmn1r61 A G 7: 5,610,818 C166R probably damaging Het
Vmn2r114 T A 17: 23,310,012 N372I probably damaging Het
Vmn2r120 T A 17: 57,509,217 M713L probably benign Het
Vmn2r61 T C 7: 42,300,586 V810A probably damaging Het
Vmn2r65 A T 7: 84,941,004 L568Q probably damaging Het
Wdr7 T C 18: 63,739,222 V409A probably damaging Het
Ylpm1 C A 12: 85,014,898 N524K unknown Het
Zfp958 A C 8: 4,628,434 H153P probably damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
impressario UTSW 9 104213886 missense probably benign 0.12
Kaiser UTSW 9 104214188 missense probably damaging 1.00
BB008:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
BB018:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
R7856:Dnajc13 UTSW 9 104167485 missense possibly damaging 0.83
R7931:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
R7995:Dnajc13 UTSW 9 104174363 missense probably damaging 1.00
R8319:Dnajc13 UTSW 9 104190391 missense probably benign 0.00
R8354:Dnajc13 UTSW 9 104217728 missense probably damaging 1.00
R8680:Dnajc13 UTSW 9 104180139 missense probably benign
R8686:Dnajc13 UTSW 9 104170805 missense probably benign 0.00
R8707:Dnajc13 UTSW 9 104192648 missense probably damaging 0.96
R8868:Dnajc13 UTSW 9 104165788 missense probably benign 0.13
R8986:Dnajc13 UTSW 9 104180131 missense probably damaging 1.00
R9139:Dnajc13 UTSW 9 104207840 missense probably benign 0.02
R9334:Dnajc13 UTSW 9 104174460 missense probably benign 0.00
R9353:Dnajc13 UTSW 9 104190372 missense probably benign 0.31
R9470:Dnajc13 UTSW 9 104230720 missense probably benign 0.01
R9528:Dnajc13 UTSW 9 104237705 missense probably benign
R9578:Dnajc13 UTSW 9 104238527 missense probably benign 0.04
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGAAGCCGTCAACAG -3'
(R):5'- TGCGTCTTTGCACACTATGAGATG -3'

Sequencing Primer
(F):5'- GCCGTCAACAGCCACCTTC -3'
(R):5'- TTTGTACAAAGAGACAGCTAGTTGG -3'
Posted On 2021-07-15