Incidental Mutation 'R8847:Iqcf6'
ID674766
Institutional Source Beutler Lab
Gene Symbol Iqcf6
Ensembl Gene ENSMUSG00000091129
Gene NameIQ motif containing F6
Synonyms100041096
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R8847 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location106626582-106627675 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106627451 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 105 (M105L)
Ref Sequence ENSEMBL: ENSMUSP00000131823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171091]
Predicted Effect probably damaging
Transcript: ENSMUST00000171091
AA Change: M105L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131823
Gene: ENSMUSG00000091129
AA Change: M105L

DomainStartEndE-ValueType
IQ 35 57 2.06e-3 SMART
IQ 91 113 8.13e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,753,709 R4T probably benign Het
Alk T A 17: 71,949,825 I680F probably benign Het
Best3 A G 10: 116,988,667 T13A possibly damaging Het
Ccdc7b A G 8: 129,145,601 D59G Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cic G A 7: 25,271,206 V121M probably damaging Het
Col6a5 A T 9: 105,864,273 N2482K possibly damaging Het
Crebbp A G 16: 4,085,027 M2116T probably benign Het
Ddn T C 15: 98,806,913 E166G possibly damaging Het
Dennd6a C T 14: 26,605,931 T249I probably benign Het
Diaph1 A T 18: 37,854,537 D1055E possibly damaging Het
Dnajc13 C A 9: 104,180,161 G1547* probably null Het
Dvl1 C T 4: 155,858,154 R626C possibly damaging Het
Fam129a A G 1: 151,700,178 E351G probably damaging Het
Fer1l6 A C 15: 58,542,163 K13Q possibly damaging Het
Fry G A 5: 150,386,007 E639K Het
Gm6408 G T 5: 146,483,792 V161L probably benign Het
Gpatch8 A T 11: 102,481,184 N509K unknown Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Ints13 T C 6: 146,556,133 T416A probably benign Het
Magi3 C A 3: 104,015,018 R1461L probably benign Het
Map3k8 A T 18: 4,333,889 L401Q Het
Miga2 G T 2: 30,383,978 R542L probably damaging Het
Mphosph9 A T 5: 124,316,146 V96E possibly damaging Het
Nek5 T C 8: 22,123,579 S28G probably benign Het
Npc1 A G 18: 12,190,930 L1275P probably damaging Het
Nphp4 C T 4: 152,506,406 R287C probably damaging Het
Olfr1333 T C 4: 118,829,624 D271G probably damaging Het
Olfr341 G A 2: 36,479,471 R220* probably null Het
Olfr406 C T 11: 74,269,617 T76I probably damaging Het
Olfr53 G C 7: 140,652,413 A145P possibly damaging Het
Parn A T 16: 13,628,406 L343* probably null Het
Pax5 T A 4: 44,691,865 D127V probably benign Het
Peak1 C A 9: 56,207,143 D1505Y probably damaging Het
Perm1 C T 4: 156,217,611 T204I probably benign Het
Pid1 A T 1: 84,115,973 S65T unknown Het
Pkn2 A G 3: 142,820,640 V392A probably benign Het
Plekhh2 A G 17: 84,571,051 D578G probably benign Het
Ppp4r4 T A 12: 103,596,488 L572Q probably damaging Het
Pum3 G A 19: 27,421,313 T279M probably damaging Het
Rasa2 A G 9: 96,576,349 V266A possibly damaging Het
Sirpb1c C T 3: 15,832,420 W264* probably null Het
Slc35g3 A T 11: 69,760,573 Y195* probably null Het
Slk T A 19: 47,619,193 H289Q Het
Spef2 T C 15: 9,668,827 S758G probably benign Het
Spon2 C T 5: 33,214,497 A322T probably benign Het
Spred2 T C 11: 20,001,064 L87P probably benign Het
Stk10 A G 11: 32,589,427 D269G Het
Tex48 T A 4: 63,612,535 probably benign Het
Themis2 T A 4: 132,786,198 H239L probably damaging Het
Tle4 T A 19: 14,516,373 R199* probably null Het
Tlr11 C T 14: 50,362,725 H723Y possibly damaging Het
Trdj2 T A 14: 54,136,780 S1T Het
Vdac1 T G 11: 52,376,403 S44A Het
Vill C T 9: 119,068,446 T647I probably damaging Het
Vmn1r61 A G 7: 5,610,818 C166R probably damaging Het
Vmn2r114 T A 17: 23,310,012 N372I probably damaging Het
Vmn2r120 T A 17: 57,509,217 M713L probably benign Het
Vmn2r61 T C 7: 42,300,586 V810A probably damaging Het
Vmn2r65 A T 7: 84,941,004 L568Q probably damaging Het
Wdr7 T C 18: 63,739,222 V409A probably damaging Het
Ylpm1 C A 12: 85,014,898 N524K unknown Het
Zfp958 A C 8: 4,628,434 H153P probably damaging Het
Other mutations in Iqcf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Iqcf6 APN 9 106627508 missense probably benign
IGL02006:Iqcf6 APN 9 106627311 missense probably benign 0.13
IGL02519:Iqcf6 APN 9 106627280 missense probably damaging 1.00
R0925:Iqcf6 UTSW 9 106627301 missense probably benign 0.00
R1493:Iqcf6 UTSW 9 106627442 missense probably benign 0.00
R4686:Iqcf6 UTSW 9 106627344 missense probably damaging 1.00
R6590:Iqcf6 UTSW 9 106627302 missense possibly damaging 0.83
R6690:Iqcf6 UTSW 9 106627302 missense possibly damaging 0.83
R7489:Iqcf6 UTSW 9 106627457 missense probably benign 0.25
R8867:Iqcf6 UTSW 9 106627499 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCCATAAAGATACAGTCATGGTGG -3'
(R):5'- TATTGGGAAGGAGATCCAGCC -3'

Sequencing Primer
(F):5'- TCATGGTGGCGTGGCAAC -3'
(R):5'- AGATCCAGCCTCCCCTG -3'
Posted On2021-07-15