Incidental Mutation 'R0730:Bsn'
ID 67477
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission 038911-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R0730 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107973221-108067583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107984011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 3348 (M3348L)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: M3348L
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: M3348L

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124763
AA Change: M576L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198370
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 25,486,774 (GRCm39) I168N probably benign Het
Adamts20 G A 15: 94,245,571 (GRCm39) A577V probably benign Het
Agtr1a A T 13: 30,565,279 (GRCm39) S115C probably damaging Het
Ankrd11 T C 8: 123,618,692 (GRCm39) Y1720C probably damaging Het
Ano6 A T 15: 95,818,252 (GRCm39) T353S probably damaging Het
App A G 16: 84,876,840 (GRCm39) F184L probably damaging Het
Arhgef38 T A 3: 132,843,232 (GRCm39) Y446F probably benign Het
Aspg T A 12: 112,078,693 (GRCm39) Y57* probably null Het
Atp1a4 G A 1: 172,067,774 (GRCm39) probably benign Het
Bdp1 G A 13: 100,195,459 (GRCm39) probably benign Het
Bicd2 T A 13: 49,531,717 (GRCm39) S246T possibly damaging Het
Brd10 T A 19: 29,695,381 (GRCm39) I1438F probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Cacna2d3 T C 14: 28,704,322 (GRCm39) I820V probably benign Het
Cdc40 A G 10: 40,720,952 (GRCm39) probably benign Het
Cdh23 T C 10: 60,159,493 (GRCm39) E2094G probably damaging Het
Celsr2 T A 3: 108,305,922 (GRCm39) N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 (GRCm39) A502V probably benign Het
Cfap54 T C 10: 92,870,599 (GRCm39) T29A probably benign Het
Cfap57 T C 4: 118,470,117 (GRCm39) probably null Het
Chd5 A G 4: 152,432,441 (GRCm39) E43G possibly damaging Het
Clk1 G A 1: 58,453,558 (GRCm39) H343Y probably benign Het
Cntn4 A C 6: 106,527,447 (GRCm39) K443T probably damaging Het
Csn2 G A 5: 87,842,811 (GRCm39) A72V possibly damaging Het
Ctdp1 T A 18: 80,493,457 (GRCm39) H346L probably benign Het
Ctif A T 18: 75,698,083 (GRCm39) N192K probably damaging Het
Ddr2 G A 1: 169,823,135 (GRCm39) A383V probably benign Het
Derl3 C T 10: 75,731,076 (GRCm39) probably benign Het
Dgkh T C 14: 78,821,919 (GRCm39) I865V probably damaging Het
Dip2b C T 15: 100,069,532 (GRCm39) A619V probably damaging Het
Elapor1 T A 3: 108,376,851 (GRCm39) H509L probably benign Het
Eml1 A G 12: 108,496,585 (GRCm39) T614A possibly damaging Het
Eogt G C 6: 97,092,970 (GRCm39) Y402* probably null Het
Erbb4 A G 1: 68,298,449 (GRCm39) V647A probably damaging Het
Esm1 G T 13: 113,350,036 (GRCm39) probably null Het
Fbxo31 A G 8: 122,282,103 (GRCm39) probably benign Het
Fbxw5 T A 2: 25,394,630 (GRCm39) D201E possibly damaging Het
Fgfr1 G A 8: 26,045,760 (GRCm39) D123N probably benign Het
G530012D18Rik A C 1: 85,504,757 (GRCm39) probably benign Het
Gnat1 G A 9: 107,556,662 (GRCm39) T29I probably damaging Het
Gtf2ird2 A T 5: 134,221,597 (GRCm39) R67* probably null Het
Il22b A T 10: 118,130,142 (GRCm39) D87E probably benign Het
Kcnq3 T C 15: 65,867,457 (GRCm39) T729A probably benign Het
Klrc2 A T 6: 129,635,659 (GRCm39) S156R probably damaging Het
Krt76 A T 15: 101,795,784 (GRCm39) L462Q probably damaging Het
Lama3 C A 18: 12,589,907 (GRCm39) probably benign Het
Lin28a A T 4: 133,735,319 (GRCm39) S56T probably damaging Het
Macf1 A G 4: 123,276,323 (GRCm39) probably benign Het
Macrod2 C T 2: 142,059,594 (GRCm39) probably benign Het
Mansc1 C T 6: 134,594,424 (GRCm39) probably benign Het
Map1b G T 13: 99,566,274 (GRCm39) S2149* probably null Het
Mgst1 A T 6: 138,124,667 (GRCm39) T34S probably benign Het
Mlf2 C T 6: 124,911,354 (GRCm39) T123M probably damaging Het
Mospd2 C T X: 163,731,253 (GRCm39) probably benign Het
Mrpl15 A T 1: 4,847,834 (GRCm39) V155E probably damaging Het
Mstn A T 1: 53,100,953 (GRCm39) Y10F possibly damaging Het
Myo1g C T 11: 6,470,794 (GRCm39) V21M probably damaging Het
Myom2 T C 8: 15,149,326 (GRCm39) I599T probably benign Het
Ndc80 A T 17: 71,803,241 (GRCm39) N633K probably benign Het
Nhs C A X: 160,620,296 (GRCm39) V1487L possibly damaging Het
Npc1 T C 18: 12,352,382 (GRCm39) T106A probably benign Het
Nup133 C T 8: 124,675,747 (GRCm39) V57M probably benign Het
Nup98 T A 7: 101,809,923 (GRCm39) T536S probably damaging Het
Oprm1 T C 10: 6,782,652 (GRCm39) probably benign Het
Or5j1 T C 2: 86,879,492 (GRCm39) I29M probably benign Het
Or6c219 T A 10: 129,780,980 (GRCm39) H317L probably benign Het
Or8j3 A G 2: 86,029,069 (GRCm39) V9A probably benign Het
Ostf1 C T 19: 18,581,571 (GRCm39) V14I unknown Het
Pcdhb14 C A 18: 37,581,921 (GRCm39) D342E probably damaging Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pdpr T C 8: 111,852,387 (GRCm39) probably null Het
Plce1 G A 19: 38,705,135 (GRCm39) V847M probably damaging Het
Pon3 A G 6: 5,230,444 (GRCm39) M288T probably benign Het
Psd2 A T 18: 36,111,627 (GRCm39) D84V possibly damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ralgapa1 T C 12: 55,712,448 (GRCm39) K1808E probably damaging Het
Ramp3 T C 11: 6,626,476 (GRCm39) probably benign Het
Rasgrf1 T A 9: 89,833,062 (GRCm39) probably benign Het
Rictor A G 15: 6,803,467 (GRCm39) probably benign Het
Rptor A T 11: 119,775,780 (GRCm39) I984F probably benign Het
Slc1a6 C T 10: 78,631,842 (GRCm39) P223S probably benign Het
Taar8b A C 10: 23,967,924 (GRCm39) V90G probably damaging Het
Tbc1d21 A G 9: 58,267,160 (GRCm39) V327A probably benign Het
Tex21 T C 12: 76,250,940 (GRCm39) T499A probably benign Het
Tg A T 15: 66,550,638 (GRCm39) D256V probably damaging Het
Tmf1 A G 6: 97,153,453 (GRCm39) S207P probably benign Het
Tpr A G 1: 150,269,158 (GRCm39) probably benign Het
Ufd1 A G 16: 18,633,637 (GRCm39) T21A probably damaging Het
Unc13a T C 8: 72,108,929 (GRCm39) D115G possibly damaging Het
Usb1 T A 8: 96,070,669 (GRCm39) F198L probably damaging Het
Utrn A T 10: 12,573,902 (GRCm39) probably benign Het
Vars1 A G 17: 35,233,276 (GRCm39) N954S probably damaging Het
Wdr17 C T 8: 55,146,131 (GRCm39) A90T possibly damaging Het
Wdr33 C T 18: 31,968,429 (GRCm39) probably benign Het
Zfp236 A G 18: 82,658,369 (GRCm39) probably benign Het
Zfp445 A T 9: 122,690,823 (GRCm39) V124E probably damaging Het
Zfp616 A T 11: 73,975,648 (GRCm39) H639L probably damaging Het
Zfyve16 C A 13: 92,657,985 (GRCm39) S642I probably damaging Het
Zswim5 C T 4: 116,842,943 (GRCm39) T896I possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 107,992,309 (GRCm39) missense probably benign 0.01
IGL00330:Bsn APN 9 107,992,539 (GRCm39) missense probably damaging 1.00
IGL00863:Bsn APN 9 107,992,521 (GRCm39) missense probably damaging 1.00
IGL01123:Bsn APN 9 107,993,185 (GRCm39) missense probably damaging 1.00
IGL01330:Bsn APN 9 107,988,112 (GRCm39) unclassified probably benign
IGL01336:Bsn APN 9 107,988,984 (GRCm39) missense probably damaging 0.99
IGL01399:Bsn APN 9 107,984,386 (GRCm39) missense unknown
IGL01683:Bsn APN 9 107,992,095 (GRCm39) missense possibly damaging 0.71
IGL02022:Bsn APN 9 107,987,617 (GRCm39) unclassified probably benign
IGL02396:Bsn APN 9 107,993,245 (GRCm39) missense possibly damaging 0.90
IGL02538:Bsn APN 9 107,982,435 (GRCm39) missense unknown
IGL02565:Bsn APN 9 107,990,487 (GRCm39) missense probably damaging 0.99
IGL02661:Bsn APN 9 107,984,135 (GRCm39) nonsense probably null
IGL02739:Bsn APN 9 107,989,745 (GRCm39) missense probably benign 0.14
IGL02951:Bsn APN 9 107,992,812 (GRCm39) missense probably damaging 1.00
IGL02987:Bsn APN 9 108,003,503 (GRCm39) missense probably benign 0.03
IGL03033:Bsn APN 9 107,993,192 (GRCm39) missense probably damaging 1.00
IGL03069:Bsn APN 9 107,991,462 (GRCm39) missense probably damaging 1.00
IGL03076:Bsn APN 9 107,982,581 (GRCm39) missense unknown
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0167:Bsn UTSW 9 108,003,185 (GRCm39) missense probably benign 0.01
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0359:Bsn UTSW 9 107,989,045 (GRCm39) missense possibly damaging 0.81
R0514:Bsn UTSW 9 108,002,981 (GRCm39) missense probably benign 0.07
R0593:Bsn UTSW 9 107,987,505 (GRCm39) missense unknown
R0617:Bsn UTSW 9 107,984,439 (GRCm39) missense unknown
R0636:Bsn UTSW 9 107,985,033 (GRCm39) missense unknown
R0652:Bsn UTSW 9 107,982,941 (GRCm39) missense unknown
R0718:Bsn UTSW 9 107,988,559 (GRCm39) unclassified probably benign
R0905:Bsn UTSW 9 107,982,834 (GRCm39) missense unknown
R0963:Bsn UTSW 9 107,989,006 (GRCm39) missense possibly damaging 0.81
R0992:Bsn UTSW 9 107,991,553 (GRCm39) nonsense probably null
R1101:Bsn UTSW 9 107,993,610 (GRCm39) missense probably damaging 1.00
R1393:Bsn UTSW 9 107,987,716 (GRCm39) unclassified probably benign
R1490:Bsn UTSW 9 107,991,193 (GRCm39) missense probably benign 0.03
R1566:Bsn UTSW 9 108,003,184 (GRCm39) missense probably benign 0.35
R1582:Bsn UTSW 9 107,982,291 (GRCm39) missense unknown
R1738:Bsn UTSW 9 107,984,133 (GRCm39) missense unknown
R1867:Bsn UTSW 9 107,983,918 (GRCm39) missense unknown
R1918:Bsn UTSW 9 107,984,772 (GRCm39) missense unknown
R1933:Bsn UTSW 9 107,993,643 (GRCm39) missense possibly damaging 0.91
R1946:Bsn UTSW 9 107,991,850 (GRCm39) missense probably damaging 0.99
R1978:Bsn UTSW 9 107,991,748 (GRCm39) missense probably benign 0.35
R2068:Bsn UTSW 9 108,003,749 (GRCm39) missense possibly damaging 0.95
R2068:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R2113:Bsn UTSW 9 107,992,085 (GRCm39) missense probably benign 0.14
R2136:Bsn UTSW 9 107,990,430 (GRCm39) missense probably damaging 1.00
R2172:Bsn UTSW 9 107,987,191 (GRCm39) intron probably benign
R2266:Bsn UTSW 9 107,992,323 (GRCm39) missense probably damaging 1.00
R2293:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2294:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2368:Bsn UTSW 9 107,988,229 (GRCm39) nonsense probably null
R2442:Bsn UTSW 9 107,984,119 (GRCm39) missense unknown
R2507:Bsn UTSW 9 107,993,313 (GRCm39) missense probably damaging 1.00
R2880:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2881:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2922:Bsn UTSW 9 107,992,668 (GRCm39) missense probably damaging 1.00
R2922:Bsn UTSW 9 107,985,385 (GRCm39) missense unknown
R3618:Bsn UTSW 9 107,994,760 (GRCm39) critical splice acceptor site probably null
R3742:Bsn UTSW 9 107,982,938 (GRCm39) missense unknown
R3825:Bsn UTSW 9 107,984,055 (GRCm39) missense unknown
R3982:Bsn UTSW 9 107,984,365 (GRCm39) missense unknown
R4094:Bsn UTSW 9 107,991,069 (GRCm39) missense probably damaging 1.00
R4158:Bsn UTSW 9 107,990,145 (GRCm39) missense possibly damaging 0.95
R4225:Bsn UTSW 9 107,983,932 (GRCm39) missense unknown
R4261:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R4482:Bsn UTSW 9 107,991,863 (GRCm39) missense probably damaging 1.00
R4515:Bsn UTSW 9 107,981,277 (GRCm39) splice site probably null
R4585:Bsn UTSW 9 107,987,662 (GRCm39) unclassified probably benign
R4628:Bsn UTSW 9 107,990,434 (GRCm39) missense probably damaging 1.00
R4636:Bsn UTSW 9 107,992,623 (GRCm39) missense probably damaging 1.00
R4679:Bsn UTSW 9 107,987,329 (GRCm39) missense unknown
R4723:Bsn UTSW 9 107,989,854 (GRCm39) missense probably benign 0.03
R4843:Bsn UTSW 9 107,984,388 (GRCm39) missense unknown
R4885:Bsn UTSW 9 107,984,726 (GRCm39) nonsense probably null
R4936:Bsn UTSW 9 107,988,960 (GRCm39) missense probably damaging 1.00
R4942:Bsn UTSW 9 107,983,678 (GRCm39) missense unknown
R4972:Bsn UTSW 9 107,992,377 (GRCm39) missense probably damaging 1.00
R4992:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R5067:Bsn UTSW 9 107,989,152 (GRCm39) missense probably damaging 1.00
R5206:Bsn UTSW 9 107,982,572 (GRCm39) missense unknown
R5286:Bsn UTSW 9 107,988,123 (GRCm39) unclassified probably benign
R5492:Bsn UTSW 9 107,989,714 (GRCm39) missense probably damaging 0.98
R5553:Bsn UTSW 9 107,987,620 (GRCm39) unclassified probably benign
R5561:Bsn UTSW 9 107,982,710 (GRCm39) missense unknown
R5597:Bsn UTSW 9 107,992,131 (GRCm39) missense probably benign 0.06
R5646:Bsn UTSW 9 107,987,631 (GRCm39) unclassified probably benign
R5796:Bsn UTSW 9 108,003,223 (GRCm39) missense probably damaging 1.00
R5801:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5802:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5850:Bsn UTSW 9 107,992,149 (GRCm39) missense probably damaging 0.99
R5938:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R6221:Bsn UTSW 9 107,982,765 (GRCm39) missense unknown
R6243:Bsn UTSW 9 107,984,760 (GRCm39) missense unknown
R6254:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.96
R6263:Bsn UTSW 9 107,990,453 (GRCm39) missense probably damaging 1.00
R6345:Bsn UTSW 9 107,984,554 (GRCm39) missense unknown
R6368:Bsn UTSW 9 107,988,513 (GRCm39) unclassified probably benign
R6574:Bsn UTSW 9 107,991,153 (GRCm39) missense possibly damaging 0.95
R6793:Bsn UTSW 9 107,991,814 (GRCm39) nonsense probably null
R6802:Bsn UTSW 9 107,987,823 (GRCm39) unclassified probably benign
R6943:Bsn UTSW 9 107,985,016 (GRCm39) missense unknown
R6999:Bsn UTSW 9 107,990,632 (GRCm39) missense probably benign 0.00
R7149:Bsn UTSW 9 107,993,520 (GRCm39) nonsense probably null
R7199:Bsn UTSW 9 107,992,533 (GRCm39) missense probably damaging 1.00
R7322:Bsn UTSW 9 108,003,620 (GRCm39) nonsense probably null
R7349:Bsn UTSW 9 107,987,982 (GRCm39) missense unknown
R7372:Bsn UTSW 9 107,987,718 (GRCm39) missense unknown
R7373:Bsn UTSW 9 107,990,683 (GRCm39) missense probably damaging 1.00
R7413:Bsn UTSW 9 108,016,690 (GRCm39) missense possibly damaging 0.61
R7473:Bsn UTSW 9 107,989,449 (GRCm39) missense probably damaging 1.00
R7482:Bsn UTSW 9 107,990,728 (GRCm39) missense probably damaging 0.98
R7530:Bsn UTSW 9 107,989,155 (GRCm39) missense probably damaging 1.00
R7549:Bsn UTSW 9 107,992,014 (GRCm39) missense probably benign 0.05
R7570:Bsn UTSW 9 107,990,742 (GRCm39) missense probably damaging 1.00
R7635:Bsn UTSW 9 107,988,189 (GRCm39) missense unknown
R7696:Bsn UTSW 9 107,991,700 (GRCm39) missense probably damaging 1.00
R7757:Bsn UTSW 9 107,991,939 (GRCm39) missense possibly damaging 0.90
R7868:Bsn UTSW 9 107,992,098 (GRCm39) missense possibly damaging 0.95
R7897:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.98
R7960:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R8022:Bsn UTSW 9 107,991,603 (GRCm39) missense probably benign 0.01
R8056:Bsn UTSW 9 107,982,506 (GRCm39) missense
R8158:Bsn UTSW 9 107,987,232 (GRCm39) missense unknown
R8161:Bsn UTSW 9 108,016,729 (GRCm39) missense probably benign 0.20
R8225:Bsn UTSW 9 107,984,305 (GRCm39) missense
R8282:Bsn UTSW 9 107,984,890 (GRCm39) missense possibly damaging 0.73
R8296:Bsn UTSW 9 107,994,578 (GRCm39) missense probably benign 0.00
R8415:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8417:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8426:Bsn UTSW 9 108,003,772 (GRCm39) missense probably damaging 1.00
R8437:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8438:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8439:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8440:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8441:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8442:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8513:Bsn UTSW 9 107,991,709 (GRCm39) missense possibly damaging 0.65
R8529:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8535:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8546:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8548:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8549:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8682:Bsn UTSW 9 107,983,368 (GRCm39) missense
R8773:Bsn UTSW 9 107,987,704 (GRCm39) missense unknown
R8883:Bsn UTSW 9 107,990,227 (GRCm39) missense probably damaging 0.98
R8906:Bsn UTSW 9 107,984,752 (GRCm39) missense unknown
R9018:Bsn UTSW 9 107,994,488 (GRCm39) missense probably benign 0.06
R9070:Bsn UTSW 9 107,987,295 (GRCm39) missense
R9094:Bsn UTSW 9 107,988,052 (GRCm39) missense unknown
R9098:Bsn UTSW 9 107,990,173 (GRCm39) missense possibly damaging 0.65
R9128:Bsn UTSW 9 107,993,349 (GRCm39) missense probably benign 0.21
R9162:Bsn UTSW 9 107,987,883 (GRCm39) missense unknown
R9224:Bsn UTSW 9 107,982,686 (GRCm39) missense
R9230:Bsn UTSW 9 107,989,459 (GRCm39) missense probably damaging 1.00
R9233:Bsn UTSW 9 107,994,289 (GRCm39) missense probably benign 0.28
R9245:Bsn UTSW 9 107,993,292 (GRCm39) missense probably damaging 1.00
R9275:Bsn UTSW 9 107,988,819 (GRCm39) missense probably damaging 1.00
R9307:Bsn UTSW 9 107,992,993 (GRCm39) missense probably benign 0.01
R9343:Bsn UTSW 9 107,992,701 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,993,361 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,990,800 (GRCm39) missense probably damaging 1.00
R9378:Bsn UTSW 9 107,984,854 (GRCm39) missense possibly damaging 0.85
R9408:Bsn UTSW 9 108,016,652 (GRCm39) nonsense probably null
R9455:Bsn UTSW 9 107,988,531 (GRCm39) missense unknown
R9563:Bsn UTSW 9 107,984,616 (GRCm39) missense
R9615:Bsn UTSW 9 107,984,430 (GRCm39) missense
R9656:Bsn UTSW 9 107,994,407 (GRCm39) missense probably benign 0.09
R9698:Bsn UTSW 9 107,993,170 (GRCm39) missense probably damaging 1.00
X0028:Bsn UTSW 9 107,990,703 (GRCm39) missense probably damaging 1.00
X0066:Bsn UTSW 9 108,016,409 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 108,016,394 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 107,982,698 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGTACCGCTGCTGTTCGTACAC -3'
(R):5'- TCGACGACATCAGCGAACTGAC -3'

Sequencing Primer
(F):5'- CCATAGGTGATTTCATCCTGGAAC -3'
(R):5'- TTGAGGGACCCACTCTGC -3'
Posted On 2013-09-03