Incidental Mutation 'R8847:Fer1l6'
ID 674782
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R8847 (G1)
Quality Score 191.009
Status Validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 58542163 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamine at position 13 (K13Q)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect possibly damaging
Transcript: ENSMUST00000161028
AA Change: K13Q

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: K13Q

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,753,709 R4T probably benign Het
Alk T A 17: 71,949,825 I680F probably benign Het
Best3 A G 10: 116,988,667 T13A possibly damaging Het
Ccdc7b A G 8: 129,145,601 D59G Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cic G A 7: 25,271,206 V121M probably damaging Het
Clasp1 C G 1: 118,578,975 P1280R probably damaging Het
Col6a5 A T 9: 105,864,273 N2482K possibly damaging Het
Crebbp A G 16: 4,085,027 M2116T probably benign Het
Ddn T C 15: 98,806,913 E166G possibly damaging Het
Dennd6a C T 14: 26,605,931 T249I probably benign Het
Diaph1 A T 18: 37,854,537 D1055E possibly damaging Het
Dnajc13 C A 9: 104,180,161 G1547* probably null Het
Dvl1 C T 4: 155,858,154 R626C possibly damaging Het
Fam126b G T 1: 58,556,554 P55Q probably damaging Het
Fam129a A G 1: 151,700,178 E351G probably damaging Het
Fry G A 5: 150,386,007 E639K Het
Gm6408 G T 5: 146,483,792 V161L probably benign Het
Gpatch8 A T 11: 102,481,184 N509K unknown Het
Ints13 T C 6: 146,556,133 T416A probably benign Het
Iqcf6 A T 9: 106,627,451 M105L probably damaging Het
Magi3 C A 3: 104,015,018 R1461L probably benign Het
Map3k8 A T 18: 4,333,889 L401Q Het
Miga2 G T 2: 30,383,978 R542L probably damaging Het
Mphosph9 A T 5: 124,316,146 V96E possibly damaging Het
Nek5 T C 8: 22,123,579 S28G probably benign Het
Notch4 A G 17: 34,584,988 probably benign Het
Npc1 A G 18: 12,190,930 L1275P probably damaging Het
Nphp4 C T 4: 152,506,406 R287C probably damaging Het
Olfr1333 T C 4: 118,829,624 D271G probably damaging Het
Olfr341 G A 2: 36,479,471 R220* probably null Het
Olfr406 C T 11: 74,269,617 T76I probably damaging Het
Olfr53 G C 7: 140,652,413 A145P possibly damaging Het
Parn A T 16: 13,628,406 L343* probably null Het
Pax5 T A 4: 44,691,865 D127V probably benign Het
Peak1 C A 9: 56,207,143 D1505Y probably damaging Het
Perm1 C T 4: 156,217,611 T204I probably benign Het
Pid1 A T 1: 84,115,973 S65T unknown Het
Pkn2 A G 3: 142,820,640 V392A probably benign Het
Plekhh2 A G 17: 84,571,051 D578G probably benign Het
Ppp4r4 T A 12: 103,596,488 L572Q probably damaging Het
Pum3 G A 19: 27,421,313 T279M probably damaging Het
Rasa2 A G 9: 96,576,349 V266A possibly damaging Het
Sirpb1c C T 3: 15,832,420 W264* probably null Het
Slc35g3 A T 11: 69,760,573 Y195* probably null Het
Slk T A 19: 47,619,193 H289Q Het
Spef2 T C 15: 9,668,827 S758G probably benign Het
Spon2 C T 5: 33,214,497 A322T probably benign Het
Spred2 T C 11: 20,001,064 L87P probably benign Het
Stk10 A G 11: 32,589,427 D269G Het
Tex48 T A 4: 63,612,535 probably benign Het
Themis2 T A 4: 132,786,198 H239L probably damaging Het
Tle4 T A 19: 14,516,373 R199* probably null Het
Tlr11 C T 14: 50,362,725 H723Y possibly damaging Het
Trdj2 T A 14: 54,136,780 S1T Het
Vdac1 T G 11: 52,376,403 S44A Het
Vill C T 9: 119,068,446 T647I probably damaging Het
Vmn1r61 A G 7: 5,610,818 C166R probably damaging Het
Vmn2r114 T A 17: 23,310,012 N372I probably damaging Het
Vmn2r120 T A 17: 57,509,217 M713L probably benign Het
Vmn2r61 T C 7: 42,300,586 V810A probably damaging Het
Vmn2r65 A T 7: 84,941,004 L568Q probably damaging Het
Wdr7 T C 18: 63,739,222 V409A probably damaging Het
Ylpm1 C A 12: 85,014,898 N524K unknown Het
Zfp958 A C 8: 4,628,434 H153P probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTGTAGATGAGGTGG -3'
(R):5'- CCCTATTTGCCAATGATGTCGG -3'

Sequencing Primer
(F):5'- AGATGAGGTGGCTGGCC -3'
(R):5'- GATGATTTCCCTGAAGCCCG -3'
Posted On 2021-07-15