Mutagenetix > Incidental Mutations

Incidental Mutation 'R8848:Cadps2'

674817

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8848 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 23344257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 897 (W897L)

Ref Sequence

ENSEMBL: ENSMUSP00000111018 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018122
AA Change: W907L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: W907L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069074
AA Change: W900L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: W900L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115358
AA Change: W907L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: W907L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115361
AA Change: W897L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: W897L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125350
AA Change: W542L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: W542L

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000142913
AA Change: W878L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: W878L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163871
AA Change: W907L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: W907L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166458
AA Change: W878L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: W878L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059G10Rik	T	C	9: 122,949,041	D46G	probably benign	Het
Abcc8	A	T	7: 46,117,345	W1004R	possibly damaging	Het
Acbd3	T	A	1: 180,734,519		probably null	Het
Adh1	G	T	3: 138,280,501	C83F	probably benign	Het
Arhgef18	T	C	8: 3,427,481	V20A	probably benign	Het
Arntl	T	C	7: 113,306,120	I506T	possibly damaging	Het
Brf2	T	C	8: 27,126,112	I82V	probably benign	Het
C7	A	G	15: 5,059,429	V10A	probably damaging	Het
Cacna1d	C	T	14: 30,123,326	V651M	possibly damaging	Het
Cacna2d2	T	C	9: 107,514,656	I458T	possibly damaging	Het
Cdhr1	T	A	14: 37,080,574	N644I	probably benign	Het
Cox7c	A	T	13: 86,045,781	I55K	possibly damaging	Het
Cox8c	T	A	12: 102,899,318		probably benign	Het
Cyp2c40	G	A	19: 39,812,800	R4C	unknown	Het
Ehd3	A	T	17: 73,829,916		probably null	Het
Eif2b4	A	T	5: 31,190,866	C227S	probably damaging	Het
Erlec1	T	C	11: 30,948,411	Y213C	probably damaging	Het
F11	G	T	8: 45,242,244	Y562*	probably null	Het
Fam186a	A	G	15: 99,940,153	S2737P	possibly damaging	Het
Fat3	T	C	9: 15,967,102	E3361G	probably damaging	Het
Fbxl7	T	A	15: 26,552,816	M122L	probably benign	Het
Fras1	T	A	5: 96,781,348	N3870K	probably damaging	Het
Gm12185	T	A	11: 48,915,453	T304S	possibly damaging	Het
Grin3b	A	T	10: 79,973,833	D391V	probably benign	Het
Hao2	T	A	3: 98,877,212	D279V	probably damaging	Het
Il4i1	C	A	7: 44,839,751	D313E	probably damaging	Het
Kcnk7	T	A	19: 5,706,715	L244Q	probably damaging	Het
Lingo4	A	T	3: 94,403,533	M593L	probably benign	Het
Lix1	G	A	17: 17,443,693	A98T	probably damaging	Het
Lpo	T	A	11: 87,817,777	I132L	probably benign	Het
Mymx	A	T	17: 45,602,009		probably null	Het
Nms	T	C	1: 38,939,310	S9P	probably benign	Het
Nom1	A	G	5: 29,440,139	D535G	probably damaging	Het
Olfr1061	T	C	2: 86,413,477	T192A	probably benign	Het
Olfr224	T	A	11: 58,567,076	I90F	probably damaging	Het
Olfr510	T	A	7: 108,667,722	I102N	probably benign	Het
Pgbd1	A	G	13: 21,422,882	C381R	probably damaging	Het
Pkp1	T	C	1: 135,879,914	S539G	probably damaging	Het
Plcd3	C	A	11: 103,080,620	R66L	probably benign	Het
Polr3a	A	T	14: 24,450,766	L1318Q	probably damaging	Het
Ppara	T	A	15: 85,788,987	F126L	possibly damaging	Het
Rab11a	T	C	9: 64,716,982	Y173C	probably damaging	Het
Rev3l	T	A	10: 39,846,709	M2566K	probably damaging	Het
Rwdd1	A	G	10: 34,008,991		probably null	Het
Scn7a	G	A	2: 66,700,049	R651*	probably null	Het
Slc15a4	T	G	5: 127,601,957	I440L	probably benign	Het
Slc28a2	A	G	2: 122,460,421	T623A	probably benign	Het
Snd1	T	A	6: 28,874,963	S628T	possibly damaging	Het
Speg	T	C	1: 75,427,438		probably null	Het
Spta1	G	A	1: 174,197,744	R725K	probably benign	Het
Stag3	A	G	5: 138,290,266	E185G	probably null	Het
Svop	G	T	5: 114,045,626	T195K		Het
Tbc1d5	A	T	17: 50,919,054	F254I	probably damaging	Het
Ulk3	T	C	9: 57,589,607	L8P	probably benign	Het
Unc13c	T	C	9: 73,525,981	I1973V	probably benign	Het
Upb1	T	A	10: 75,428,344		probably null	Het
Usp53	C	T	3: 122,949,176	G704S	probably benign	Het
Usp53	T	C	3: 122,949,586	D567G	probably benign	Het
Vmn1r72	T	A	7: 11,670,342	I60F	probably damaging	Het
Vmn2r34	C	T	7: 7,672,308	V694I	probably benign	Het
Vmn2r60	T	C	7: 42,136,745	F324S	probably damaging	Het
Vps37d	A	G	5: 135,073,665	S238P	probably damaging	Het
Zfp407	T	A	18: 84,560,694	I765F	probably damaging	Het
Zfp455	A	G	13: 67,208,025	I387M	possibly damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAGGAATCATCTGCCATAGG -3'
(R):5'- ACATGTTTTCGGGAGCATAGTG -3'

Sequencing Primer
(F):5'- TGACATCATAGACTCAGAGAAGCTC -3'
(R):5'- GTGTTTGTCCATGCTTCTAACAAG -3'

Posted On

2021-07-15