Incidental Mutation 'R8848:Polr3a'
ID 674847
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission 068671-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8848 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24500834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1318 (L1318Q)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: L1318Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: L1318Q

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Meta Mutation Damage Score 0.7760 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T C 9: 122,778,106 (GRCm39) D46G probably benign Het
Abcc8 A T 7: 45,766,769 (GRCm39) W1004R possibly damaging Het
Acbd3 T A 1: 180,562,084 (GRCm39) probably null Het
Adh1 G T 3: 137,986,262 (GRCm39) C83F probably benign Het
Arhgef18 T C 8: 3,477,481 (GRCm39) V20A probably benign Het
Bmal1 T C 7: 112,905,327 (GRCm39) I506T possibly damaging Het
Brf2 T C 8: 27,616,140 (GRCm39) I82V probably benign Het
C7 A G 15: 5,088,911 (GRCm39) V10A probably damaging Het
Cacna1d C T 14: 29,845,283 (GRCm39) V651M possibly damaging Het
Cacna2d2 T C 9: 107,391,855 (GRCm39) I458T possibly damaging Het
Cadps2 C A 6: 23,344,256 (GRCm39) W897L probably damaging Het
Cdhr1 T A 14: 36,802,531 (GRCm39) N644I probably benign Het
Cox7c A T 13: 86,193,900 (GRCm39) I55K possibly damaging Het
Cox8c T A 12: 102,865,577 (GRCm39) probably benign Het
Cyp2c40 G A 19: 39,801,244 (GRCm39) R4C unknown Het
Ehd3 A T 17: 74,136,911 (GRCm39) probably null Het
Eif2b4 A T 5: 31,348,210 (GRCm39) C227S probably damaging Het
Erlec1 T C 11: 30,898,411 (GRCm39) Y213C probably damaging Het
F11 G T 8: 45,695,281 (GRCm39) Y562* probably null Het
Fam186a A G 15: 99,838,034 (GRCm39) S2737P possibly damaging Het
Fat3 T C 9: 15,878,398 (GRCm39) E3361G probably damaging Het
Fbxl7 T A 15: 26,552,902 (GRCm39) M122L probably benign Het
Fras1 T A 5: 96,929,207 (GRCm39) N3870K probably damaging Het
Gm12185 T A 11: 48,806,280 (GRCm39) T304S possibly damaging Het
Grin3b A T 10: 79,809,667 (GRCm39) D391V probably benign Het
Hao2 T A 3: 98,784,528 (GRCm39) D279V probably damaging Het
Il4i1 C A 7: 44,489,175 (GRCm39) D313E probably damaging Het
Kcnk7 T A 19: 5,756,743 (GRCm39) L244Q probably damaging Het
Lingo4 A T 3: 94,310,840 (GRCm39) M593L probably benign Het
Lix1 G A 17: 17,663,955 (GRCm39) A98T probably damaging Het
Lpo T A 11: 87,708,603 (GRCm39) I132L probably benign Het
Mymx A T 17: 45,912,935 (GRCm39) probably null Het
Nms T C 1: 38,978,391 (GRCm39) S9P probably benign Het
Nom1 A G 5: 29,645,137 (GRCm39) D535G probably damaging Het
Or2t43 T A 11: 58,457,902 (GRCm39) I90F probably damaging Het
Or5p81 T A 7: 108,266,929 (GRCm39) I102N probably benign Het
Or8k25 T C 2: 86,243,821 (GRCm39) T192A probably benign Het
Pgbd1 A G 13: 21,607,052 (GRCm39) C381R probably damaging Het
Pkp1 T C 1: 135,807,652 (GRCm39) S539G probably damaging Het
Plcd3 C A 11: 102,971,446 (GRCm39) R66L probably benign Het
Ppara T A 15: 85,673,188 (GRCm39) F126L possibly damaging Het
Rab11a T C 9: 64,624,264 (GRCm39) Y173C probably damaging Het
Rev3l T A 10: 39,722,705 (GRCm39) M2566K probably damaging Het
Rwdd1 A G 10: 33,884,987 (GRCm39) probably null Het
Scn7a G A 2: 66,530,393 (GRCm39) R651* probably null Het
Slc15a4 T G 5: 127,679,021 (GRCm39) I440L probably benign Het
Slc28a2 A G 2: 122,290,902 (GRCm39) T623A probably benign Het
Snd1 T A 6: 28,874,962 (GRCm39) S628T possibly damaging Het
Speg T C 1: 75,404,082 (GRCm39) probably null Het
Spta1 G A 1: 174,025,310 (GRCm39) R725K probably benign Het
Stag3 A G 5: 138,288,528 (GRCm39) E185G probably null Het
Svop G T 5: 114,183,687 (GRCm39) T195K Het
Tbc1d5 A T 17: 51,226,082 (GRCm39) F254I probably damaging Het
Ulk3 T C 9: 57,496,890 (GRCm39) L8P probably benign Het
Unc13c T C 9: 73,433,263 (GRCm39) I1973V probably benign Het
Upb1 T A 10: 75,264,178 (GRCm39) probably null Het
Usp53 C T 3: 122,742,825 (GRCm39) G704S probably benign Het
Usp53 T C 3: 122,743,235 (GRCm39) D567G probably benign Het
Vmn1r72 T A 7: 11,404,269 (GRCm39) I60F probably damaging Het
Vmn2r34 C T 7: 7,675,307 (GRCm39) V694I probably benign Het
Vmn2r60 T C 7: 41,786,169 (GRCm39) F324S probably damaging Het
Vps37d A G 5: 135,102,519 (GRCm39) S238P probably damaging Het
Zfp407 T A 18: 84,578,819 (GRCm39) I765F probably damaging Het
Zfp455 A G 13: 67,356,089 (GRCm39) I387M possibly damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAACATGTAGGTCAGTGGG -3'
(R):5'- TCCTTGAGTAGCTGCATGGC -3'

Sequencing Primer
(F):5'- TTCAAGGACTCAGGAGCCATAGATTC -3'
(R):5'- AGTAGCTGCATGGCTGGTTTTG -3'
Posted On 2021-07-15