Incidental Mutation 'R8849:Ccser1'
ID 674878
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Name coiled-coil serine rich 1
Synonyms 6230405M12Rik, C130092O11Rik, Fam190a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock # R8849 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 61180324-62382865 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61311553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 233 (D233E)
Ref Sequence ENSEMBL: ENSMUSP00000040251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
AlphaFold Q8C0C4
Predicted Effect probably benign
Transcript: ENSMUST00000045522
AA Change: D233E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: D233E

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126214
AA Change: D233E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: D233E

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik G A 16: 14,621,512 probably null Het
Adgrv1 T C 13: 81,521,205 T2411A probably benign Het
Aldh5a1 T A 13: 24,937,481 T30S probably benign Het
Alg1 G A 16: 5,233,668 A7T possibly damaging Het
Ano10 T A 9: 122,261,444 M268L probably benign Het
Avil T C 10: 127,008,792 V264A possibly damaging Het
Bicc1 T A 10: 70,946,864 I558F probably benign Het
Bst1 A T 5: 43,820,585 H92L possibly damaging Het
C1s2 T C 6: 124,625,795 N486D probably benign Het
C87414 A T 5: 93,636,338 H422Q probably benign Het
C87499 T A 4: 88,627,777 T443S probably benign Het
Carmil3 A T 14: 55,497,170 H452L probably benign Het
Ceacam18 G T 7: 43,645,543 L342F probably benign Het
Cep95 T A 11: 106,816,804 M691K Het
Cfap221 G A 1: 119,995,144 P23S probably damaging Het
Col20a1 T C 2: 180,998,639 Y572H probably damaging Het
Cr2 C T 1: 195,157,239 V627M probably damaging Het
Cul2 T A 18: 3,423,551 H320Q probably benign Het
Ddx5 A T 11: 106,785,149 V266E probably damaging Het
Dgkd T C 1: 87,918,643 V336A probably damaging Het
Dnah6 T C 6: 73,144,173 probably null Het
Dnhd1 C A 7: 105,721,516 Q4668K probably benign Het
Dock7 C T 4: 99,016,749 E630K Het
Dolk T C 2: 30,284,923 E370G probably damaging Het
Ercc6 T A 14: 32,569,608 L1003Q probably damaging Het
Fam96b C T 8: 104,640,967 probably null Het
Foxc1 T C 13: 31,808,834 S543P unknown Het
Gbp2b A C 3: 142,608,152 M398L probably benign Het
Gigyf2 G T 1: 87,433,870 R908L unknown Het
Gm13023 A G 4: 143,795,026 N404S probably damaging Het
Gpr176 T A 2: 118,279,614 E388V probably damaging Het
Gpx8 C T 13: 113,043,170 G199E probably benign Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Ifi208 G A 1: 173,678,618 probably benign Het
Itgad T A 7: 128,189,985 probably benign Het
Kif20b C T 19: 34,938,316 Q498* probably null Het
Lmo7 T C 14: 101,926,107 Y1463H unknown Het
Mms19 A T 19: 41,964,328 L114Q probably damaging Het
Mogs T C 6: 83,118,005 V601A possibly damaging Het
Mybpc1 T A 10: 88,571,585 M87L probably benign Het
Nhlrc2 T C 19: 56,591,752 V439A possibly damaging Het
Npc1l1 T A 11: 6,229,038 H124L probably damaging Het
Olfr1360 T C 13: 21,674,056 E296G possibly damaging Het
Opn4 A G 14: 34,597,029 W200R probably damaging Het
Pax2 T C 19: 44,760,672 probably benign Het
Phf20 G T 2: 156,276,520 Q381H probably damaging Het
Rb1 C T 14: 73,197,269 R903Q probably damaging Het
Scamp4 T A 10: 80,609,432 V37E probably damaging Het
Sema3e T C 5: 14,252,659 W733R probably damaging Het
Sertm1 A G 3: 54,899,328 V92A possibly damaging Het
Slc4a5 T C 6: 83,273,198 F638L probably damaging Het
Tprn T C 2: 25,269,159 S703P probably damaging Het
Tulp4 T A 17: 6,222,381 M570K probably benign Het
Zfp433 T C 10: 81,721,041 I459T probably benign Het
Zfp697 A G 3: 98,427,627 E236G probably benign Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62380142 missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61810665 nonsense probably null
IGL01012:Ccser1 APN 6 61638490 missense probably benign 0.01
IGL01391:Ccser1 APN 6 61638521 splice site probably benign
IGL01643:Ccser1 APN 6 61311855 missense probably benign 0.01
IGL01767:Ccser1 APN 6 61718152 missense probably benign 0.03
IGL02081:Ccser1 APN 6 61311168 nonsense probably null
IGL02152:Ccser1 APN 6 61311708 missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61311292 missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62379831 missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R0020:Ccser1 UTSW 6 61313804 missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61423061 missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62380106 missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62380032 missense probably benign 0.00
R1650:Ccser1 UTSW 6 61638490 missense probably benign 0.01
R1653:Ccser1 UTSW 6 61311465 missense probably benign 0.00
R1913:Ccser1 UTSW 6 62379894 missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61313646 splice site probably benign
R2030:Ccser1 UTSW 6 61311563 missense probably benign
R2056:Ccser1 UTSW 6 61422952 splice site probably null
R2268:Ccser1 UTSW 6 61570843 missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61422960 missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61311584 missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61311926 missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61311501 missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61718191 missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61311366 missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R5221:Ccser1 UTSW 6 61312091 missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61311666 missense probably benign 0.00
R5604:Ccser1 UTSW 6 61313804 missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61311276 missense probably benign 0.00
R5970:Ccser1 UTSW 6 61311242 missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 61373962 missense probably damaging 0.96
R6257:Ccser1 UTSW 6 62379785 missense probably benign
R6375:Ccser1 UTSW 6 61311168 nonsense probably null
R6703:Ccser1 UTSW 6 61638511 nonsense probably null
R6930:Ccser1 UTSW 6 62380025 missense probably benign 0.03
R7256:Ccser1 UTSW 6 61311867 missense probably benign 0.38
R7362:Ccser1 UTSW 6 61810880 missense unknown
R7508:Ccser1 UTSW 6 61570723 missense probably benign 0.05
R7532:Ccser1 UTSW 6 62379931 nonsense probably null
R7533:Ccser1 UTSW 6 61638490 missense probably benign 0.25
R7729:Ccser1 UTSW 6 61311856 missense probably benign
R7875:Ccser1 UTSW 6 61311948 missense probably benign 0.06
R8055:Ccser1 UTSW 6 61313773 missense possibly damaging 0.47
R8396:Ccser1 UTSW 6 61312104 missense probably benign 0.09
R8724:Ccser1 UTSW 6 61311215 missense probably damaging 0.99
R8906:Ccser1 UTSW 6 61810858 missense probably benign 0.00
R9058:Ccser1 UTSW 6 61373992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGGGACGATTCTGGATTC -3'
(R):5'- CATTGTGGCCAAAATTGTCACAG -3'

Sequencing Primer
(F):5'- AAGTCGCCGTTCTATTAAACAGTCC -3'
(R):5'- CCAAAATTGTCACAGTGTGATGCC -3'
Posted On 2021-07-15