Incidental Mutation 'R8849:Nhlrc2'
ID674913
Institutional Source Beutler Lab
Gene Symbol Nhlrc2
Ensembl Gene ENSMUSG00000025078
Gene NameNHL repeat containing 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8849 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location56548261-56598846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56591752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 439 (V439A)
Ref Sequence ENSEMBL: ENSMUSP00000071370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071423
AA Change: V439A

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078
AA Change: V439A

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik G A 16: 14,621,512 probably null Het
Adgrv1 T C 13: 81,521,205 T2411A probably benign Het
Aldh5a1 T A 13: 24,937,481 T30S probably benign Het
Alg1 G A 16: 5,233,668 A7T possibly damaging Het
Ano10 T A 9: 122,261,444 M268L probably benign Het
Avil T C 10: 127,008,792 V264A possibly damaging Het
Bicc1 T A 10: 70,946,864 I558F probably benign Het
Bst1 A T 5: 43,820,585 H92L possibly damaging Het
C1s2 T C 6: 124,625,795 N486D probably benign Het
C87414 A T 5: 93,636,338 H422Q probably benign Het
C87499 T A 4: 88,627,777 T443S probably benign Het
Carmil3 A T 14: 55,497,170 H452L probably benign Het
Ccser1 T A 6: 61,311,553 D233E probably benign Het
Ceacam18 G T 7: 43,645,543 L342F probably benign Het
Cep95 T A 11: 106,816,804 M691K Het
Cfap221 G A 1: 119,995,144 P23S probably damaging Het
Col20a1 T C 2: 180,998,639 Y572H probably damaging Het
Cr2 C T 1: 195,157,239 V627M probably damaging Het
Cul2 T A 18: 3,423,551 H320Q probably benign Het
Ddx5 A T 11: 106,785,149 V266E probably damaging Het
Dgkd T C 1: 87,918,643 V336A probably damaging Het
Dnah6 T C 6: 73,144,173 probably null Het
Dnhd1 C A 7: 105,721,516 Q4668K probably benign Het
Dock7 C T 4: 99,016,749 E630K Het
Dolk T C 2: 30,284,923 E370G probably damaging Het
Ercc6 T A 14: 32,569,608 L1003Q probably damaging Het
Fam96b C T 8: 104,640,967 probably null Het
Foxc1 T C 13: 31,808,834 S543P unknown Het
Gbp2b A C 3: 142,608,152 M398L probably benign Het
Gigyf2 G T 1: 87,433,870 R908L unknown Het
Gm13023 A G 4: 143,795,026 N404S probably damaging Het
Gpr176 T A 2: 118,279,614 E388V probably damaging Het
Gpx8 C T 13: 113,043,170 G199E probably benign Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Kif20b C T 19: 34,938,316 Q498* probably null Het
Lmo7 T C 14: 101,926,107 Y1463H unknown Het
Mms19 A T 19: 41,964,328 L114Q probably damaging Het
Mogs T C 6: 83,118,005 V601A possibly damaging Het
Mybpc1 T A 10: 88,571,585 M87L probably benign Het
Npc1l1 T A 11: 6,229,038 H124L probably damaging Het
Olfr1360 T C 13: 21,674,056 E296G possibly damaging Het
Opn4 A G 14: 34,597,029 W200R probably damaging Het
Pax2 T C 19: 44,760,672 probably benign Het
Phf20 G T 2: 156,276,520 Q381H probably damaging Het
Rb1 C T 14: 73,197,269 R903Q probably damaging Het
Scamp4 T A 10: 80,609,432 V37E probably damaging Het
Sema3e T C 5: 14,252,659 W733R probably damaging Het
Sertm1 A G 3: 54,899,328 V92A possibly damaging Het
Slc4a5 T C 6: 83,273,198 F638L probably damaging Het
Tprn T C 2: 25,269,159 S703P probably damaging Het
Tulp4 T A 17: 6,222,381 M570K probably benign Het
Zfp433 T C 10: 81,721,041 I459T probably benign Het
Zfp697 A G 3: 98,427,627 E236G probably benign Het
Other mutations in Nhlrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Nhlrc2 APN 19 56551799 nonsense probably null
IGL01524:Nhlrc2 APN 19 56576155 missense probably benign 0.39
IGL01570:Nhlrc2 APN 19 56574787 missense possibly damaging 0.87
IGL01653:Nhlrc2 APN 19 56570850 missense probably benign 0.25
IGL02256:Nhlrc2 APN 19 56597361 missense probably benign 0.10
IGL02303:Nhlrc2 APN 19 56574848 missense probably damaging 1.00
IGL02349:Nhlrc2 APN 19 56591719 missense possibly damaging 0.94
IGL02501:Nhlrc2 APN 19 56570654 nonsense probably null
R0270:Nhlrc2 UTSW 19 56551870 missense probably damaging 1.00
R0454:Nhlrc2 UTSW 19 56570527 missense probably damaging 1.00
R2022:Nhlrc2 UTSW 19 56597278 missense probably benign 0.06
R3854:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3855:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3856:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R4659:Nhlrc2 UTSW 19 56576267 missense possibly damaging 0.86
R4767:Nhlrc2 UTSW 19 56570466 missense probably benign 0.03
R4992:Nhlrc2 UTSW 19 56570534 missense probably benign 0.00
R5877:Nhlrc2 UTSW 19 56570584 missense probably damaging 1.00
R6191:Nhlrc2 UTSW 19 56570859 missense probably benign 0.00
R6755:Nhlrc2 UTSW 19 56591784 missense probably benign 0.12
R7164:Nhlrc2 UTSW 19 56592499 missense probably damaging 1.00
R7507:Nhlrc2 UTSW 19 56597378 missense not run
R7609:Nhlrc2 UTSW 19 56594896 missense probably benign
R8811:Nhlrc2 UTSW 19 56594912 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGAGCTTGTCTTTCAGTGACC -3'
(R):5'- TTTCTCAGAGGGAGGGCTTTAC -3'

Sequencing Primer
(F):5'- ATATCCTCACAAGGCAGG -3'
(R):5'- TGGAACTCTCTCTGTAGACCAGG -3'
Posted On2021-07-15