Incidental Mutation 'R8850:Adgrd1'
ID 674940
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Name adhesion G protein-coupled receptor D1
Synonyms E230012M21Rik, Gpr133
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8850 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 129096750-129204599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129142510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 465 (K465E)
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
AlphaFold Q80T32
Predicted Effect probably benign
Transcript: ENSMUST00000056617
AA Change: K465E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: K465E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156437
AA Change: K433E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: K433E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 G A 12: 70,942,258 probably null Het
Aktip A T 8: 91,126,774 V105E probably benign Het
Ankrd7 A G 6: 18,870,007 Y253C probably damaging Het
Bag6 T C 17: 35,142,065 M440T unknown Het
Camk2b T A 11: 5,972,838 N426Y probably damaging Het
Ccdc82 T A 9: 13,289,352 Y500* probably null Het
Cenpe T A 3: 135,225,016 D341E probably damaging Het
Cyp2j13 A T 4: 96,068,191 M227K probably benign Het
Dmbt1 G A 7: 131,090,404 V967I unknown Het
Dnmt3b A T 2: 153,674,013 N447Y probably benign Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Dtymk A C 1: 93,801,821 S3A probably benign Het
Eefsec G A 6: 88,446,271 T70M possibly damaging Het
Fam171a1 C T 2: 3,220,307 T270M probably damaging Het
Gm17677 A G 9: 35,741,095 Y16C probably damaging Het
Gm17728 T C 17: 9,422,327 S90P probably benign Het
Hdlbp A G 1: 93,431,331 L213P probably damaging Het
Heatr5b T C 17: 78,801,759 I1024V probably benign Het
Hr C T 14: 70,561,865 R597* probably null Het
Ifit3 T C 19: 34,587,588 I178T probably damaging Het
Ifna6 A G 4: 88,827,985 *190W probably null Het
Igkv4-55 A T 6: 69,607,331 M99K probably benign Het
Klk1 T A 7: 44,227,632 I53N probably damaging Het
Lpcat2b A G 5: 107,432,826 H7R probably benign Het
Lrrc37a G A 11: 103,502,655 P648L Het
Mast4 G T 13: 102,758,666 P975H probably damaging Het
Mfrp C T 9: 44,102,510 L106F probably benign Het
Mllt10 T A 2: 18,196,658 S652T probably benign Het
Mroh8 C A 2: 157,241,753 G400W probably damaging Het
Neurl4 A G 11: 69,903,962 probably benign Het
Nop14 A C 5: 34,660,008 V13G probably benign Het
Nup188 T A 2: 30,327,564 L837Q probably damaging Het
Olfr1089 T C 2: 86,732,958 Y218C probably damaging Het
Olfr318 T A 11: 58,720,746 T101S probably benign Het
Olfr441 T A 6: 43,115,971 N76K possibly damaging Het
Olfr849 T C 9: 19,441,521 S203P probably damaging Het
Pde8b A T 13: 95,090,285 V185E probably benign Het
Pink1 G T 4: 138,320,022 A247D probably damaging Het
Pla2g10 A T 16: 13,728,050 V40D probably damaging Het
Plce1 G A 19: 38,524,367 G37R probably benign Het
Pld1 A G 3: 28,112,290 E826G possibly damaging Het
Poc5 G T 13: 96,398,720 K164N possibly damaging Het
Polr2b A T 5: 77,315,914 M53L probably benign Het
Ppp1r10 C T 17: 35,928,798 P470S probably damaging Het
Rasef A G 4: 73,727,603 S510P probably damaging Het
Rnf17 T A 14: 56,485,201 L1073Q probably damaging Het
Rpl13a-ps1 C T 19: 50,030,300 G146R probably damaging Het
Scn2a A G 2: 65,688,386 D368G probably damaging Het
Shc3 T A 13: 51,480,212 S86C probably benign Het
Sos1 T C 17: 80,433,976 H460R probably damaging Het
Steap1 T A 5: 5,740,838 M37L probably benign Het
Themis G T 10: 28,797,496 C593F possibly damaging Het
Tnn A G 1: 160,110,244 probably null Het
Trabd G T 15: 89,085,464 probably benign Het
Trim42 T A 9: 97,365,994 K216N probably damaging Het
Trmt44 G A 5: 35,564,329 P497S probably benign Het
Trp53bp2 A G 1: 182,428,910 Y15C probably damaging Het
Trpm7 T A 2: 126,810,180 I1458L probably benign Het
Ttc17 G T 2: 94,406,658 A3E possibly damaging Het
Ttn C A 2: 76,873,864 V9274L unknown Het
Vmn2r105 T A 17: 20,208,610 I735F probably damaging Het
Vmn2r22 A G 6: 123,637,495 C379R probably damaging Het
Vmn2r97 G A 17: 18,929,345 E332K probably benign Het
Xrn1 A G 9: 96,038,679 T1331A probably benign Het
Zcchc6 T A 13: 59,789,197 Q1212L possibly damaging Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129131577 missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129178100 missense probably benign 0.02
R1709:Adgrd1 UTSW 5 129179228 missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7300:Adgrd1 UTSW 5 129097347 critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
R8205:Adgrd1 UTSW 5 129115111 missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129188371 missense possibly damaging 0.94
R8780:Adgrd1 UTSW 5 129097074 start gained probably benign
R9528:Adgrd1 UTSW 5 129179676 missense probably benign 0.44
R9569:Adgrd1 UTSW 5 129179637 missense possibly damaging 0.90
R9626:Adgrd1 UTSW 5 129198657 missense probably damaging 1.00
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCATGCTGTTGTAAATGTCATGG -3'
(R):5'- TCTCCAAAGGACTCGAAGCC -3'

Sequencing Primer
(F):5'- AAATGTCATGGTCTTGTGGCTC -3'
(R):5'- CCAACCTGGCTTGAACAAGG -3'
Posted On 2021-07-15