Incidental Mutation 'R8850:Ifit3'
ID 674975
Institutional Source Beutler Lab
Gene Symbol Ifit3
Ensembl Gene ENSMUSG00000074896
Gene Name interferon-induced protein with tetratricopeptide repeats 3
Synonyms Ifi49
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8850 (G1)
Quality Score 166.009
Status Validated
Chromosome 19
Chromosomal Location 34583531-34588731 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34587588 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 178 (I178T)
Ref Sequence ENSEMBL: ENSMUSP00000099889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102825]
AlphaFold Q64345
Predicted Effect probably damaging
Transcript: ENSMUST00000102825
AA Change: I178T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099889
Gene: ENSMUSG00000074896
AA Change: I178T

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 6e-6 BLAST
low complexity region 209 218 N/A INTRINSIC
TPR 241 274 1.02e1 SMART
Meta Mutation Damage Score 0.8266 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 G A 12: 70,942,258 probably null Het
Adgrd1 A G 5: 129,142,510 K465E probably benign Het
Aktip A T 8: 91,126,774 V105E probably benign Het
Ankrd7 A G 6: 18,870,007 Y253C probably damaging Het
Bag6 T C 17: 35,142,065 M440T unknown Het
Camk2b T A 11: 5,972,838 N426Y probably damaging Het
Ccdc82 T A 9: 13,289,352 Y500* probably null Het
Cenpe T A 3: 135,225,016 D341E probably damaging Het
Cyp2j13 A T 4: 96,068,191 M227K probably benign Het
Dmbt1 G A 7: 131,090,404 V967I unknown Het
Dnmt3b A T 2: 153,674,013 N447Y probably benign Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Dtymk A C 1: 93,801,821 S3A probably benign Het
Eefsec G A 6: 88,446,271 T70M possibly damaging Het
Fam171a1 C T 2: 3,220,307 T270M probably damaging Het
Gm17677 A G 9: 35,741,095 Y16C probably damaging Het
Gm17728 T C 17: 9,422,327 S90P probably benign Het
Hdlbp A G 1: 93,431,331 L213P probably damaging Het
Heatr5b T C 17: 78,801,759 I1024V probably benign Het
Hr C T 14: 70,561,865 R597* probably null Het
Ifna6 A G 4: 88,827,985 *190W probably null Het
Igkv4-55 A T 6: 69,607,331 M99K probably benign Het
Klk1 T A 7: 44,227,632 I53N probably damaging Het
Lpcat2b A G 5: 107,432,826 H7R probably benign Het
Lrrc37a G A 11: 103,502,655 P648L Het
Mast4 G T 13: 102,758,666 P975H probably damaging Het
Mfrp C T 9: 44,102,510 L106F probably benign Het
Mllt10 T A 2: 18,196,658 S652T probably benign Het
Mroh8 C A 2: 157,241,753 G400W probably damaging Het
Neurl4 A G 11: 69,903,962 probably benign Het
Nop14 A C 5: 34,660,008 V13G probably benign Het
Nup188 T A 2: 30,327,564 L837Q probably damaging Het
Olfr1089 T C 2: 86,732,958 Y218C probably damaging Het
Olfr318 T A 11: 58,720,746 T101S probably benign Het
Olfr441 T A 6: 43,115,971 N76K possibly damaging Het
Olfr849 T C 9: 19,441,521 S203P probably damaging Het
Pde8b A T 13: 95,090,285 V185E probably benign Het
Pink1 G T 4: 138,320,022 A247D probably damaging Het
Pla2g10 A T 16: 13,728,050 V40D probably damaging Het
Plce1 G A 19: 38,524,367 G37R probably benign Het
Pld1 A G 3: 28,112,290 E826G possibly damaging Het
Poc5 G T 13: 96,398,720 K164N possibly damaging Het
Polr2b A T 5: 77,315,914 M53L probably benign Het
Ppp1r10 C T 17: 35,928,798 P470S probably damaging Het
Rasef A G 4: 73,727,603 S510P probably damaging Het
Rnf17 T A 14: 56,485,201 L1073Q probably damaging Het
Rpl13a-ps1 C T 19: 50,030,300 G146R probably damaging Het
Scn2a A G 2: 65,688,386 D368G probably damaging Het
Shc3 T A 13: 51,480,212 S86C probably benign Het
Sos1 T C 17: 80,433,976 H460R probably damaging Het
Steap1 T A 5: 5,740,838 M37L probably benign Het
Themis G T 10: 28,797,496 C593F possibly damaging Het
Tnn A G 1: 160,110,244 probably null Het
Trabd G T 15: 89,085,464 probably benign Het
Trim42 T A 9: 97,365,994 K216N probably damaging Het
Trmt44 G A 5: 35,564,329 P497S probably benign Het
Trp53bp2 A G 1: 182,428,910 Y15C probably damaging Het
Trpm7 T A 2: 126,810,180 I1458L probably benign Het
Ttc17 G T 2: 94,406,658 A3E possibly damaging Het
Ttn C A 2: 76,873,864 V9274L unknown Het
Vmn2r105 T A 17: 20,208,610 I735F probably damaging Het
Vmn2r22 A G 6: 123,637,495 C379R probably damaging Het
Vmn2r97 G A 17: 18,929,345 E332K probably benign Het
Xrn1 A G 9: 96,038,679 T1331A probably benign Het
Zcchc6 T A 13: 59,789,197 Q1212L possibly damaging Het
Other mutations in Ifit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1501:Ifit3 UTSW 19 34588251 missense probably benign 0.13
R1521:Ifit3 UTSW 19 34587173 missense probably damaging 1.00
R3084:Ifit3 UTSW 19 34587240 missense probably damaging 0.99
R5017:Ifit3 UTSW 19 34587192 missense possibly damaging 0.78
R5306:Ifit3 UTSW 19 34587807 missense probably damaging 1.00
R6194:Ifit3 UTSW 19 34587627 missense probably benign 0.06
R6523:Ifit3 UTSW 19 34588155 missense probably benign 0.10
R6559:Ifit3 UTSW 19 34587114 missense probably damaging 1.00
R7535:Ifit3 UTSW 19 34587880 missense probably damaging 0.98
R7947:Ifit3 UTSW 19 34587959 nonsense probably null
R8049:Ifit3 UTSW 19 34588080 missense possibly damaging 0.88
R8142:Ifit3 UTSW 19 34587501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACAAGGTGAGACAAGTTTGC -3'
(R):5'- AAACTGAGCTGCCTTTTGGAG -3'

Sequencing Primer
(F):5'- TGCCAAAAGTTTGCGAATCC -3'
(R):5'- CGTTTGATTAGGAGCTTTCCCCAAAG -3'
Posted On 2021-07-15