Incidental Mutation 'R8851:Ism1'
ID 674985
Institutional Source Beutler Lab
Gene Symbol Ism1
Ensembl Gene ENSMUSG00000074766
Gene Name isthmin 1, angiogenesis inhibitor
Synonyms 5430433G21Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock # R8851 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 139678178-139758581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 139749545 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 273 (S273I)
Ref Sequence ENSEMBL: ENSMUSP00000139280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099307] [ENSMUST00000184404]
AlphaFold A2ATD1
Predicted Effect probably damaging
Transcript: ENSMUST00000099307
AA Change: S266I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096910
Gene: ENSMUSG00000074766
AA Change: S266I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
TSP1 210 252 3.69e-8 SMART
AMOP 279 442 5.38e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184404
AA Change: S273I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139280
Gene: ENSMUSG00000074766
AA Change: S273I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 172 184 N/A INTRINSIC
TSP1 217 259 3.69e-8 SMART
AMOP 286 449 5.38e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,116 I279F probably benign Het
Adamts7 A G 9: 90,193,110 N965S probably benign Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankar T C 1: 72,652,376 Y1142C probably damaging Het
Apoa4 A G 9: 46,242,608 K169R probably benign Het
AY761184 T A 8: 21,703,539 I22F possibly damaging Het
Cd22 T A 7: 30,877,659 K74N probably benign Het
Dgcr2 G A 16: 17,872,643 T41I possibly damaging Het
Dicer1 A G 12: 104,724,041 V245A possibly damaging Het
Dopey2 T A 16: 93,762,510 S715T probably benign Het
Epb41l1 A T 2: 156,522,511 H980L probably benign Het
Erc2 A T 14: 28,317,259 E973V probably null Het
Fam124b T A 1: 80,213,165 Q167L probably damaging Het
Frmpd2 A G 14: 33,495,686 E46G probably damaging Het
Gabrb2 G A 11: 42,421,359 V4I probably benign Het
Gbf1 T A 19: 46,268,483 N841K probably damaging Het
Gnpat A G 8: 124,874,265 H161R probably damaging Het
Gpd2 A T 2: 57,307,050 M206L possibly damaging Het
Grid2ip T C 5: 143,362,597 F148L possibly damaging Het
Hemk1 A G 9: 107,336,213 V128A probably benign Het
Kcnab3 G T 11: 69,328,164 probably null Het
Kdm6b A G 11: 69,401,167 Y1430H unknown Het
Lama2 A G 10: 27,366,123 V279A possibly damaging Het
Lmf1 G A 17: 25,585,706 W119* probably null Het
Lrrc42 A G 4: 107,239,178 V276A probably benign Het
Magi2 T C 5: 20,065,620 F163L probably damaging Het
Map2k2 A G 10: 81,119,263 K196R probably damaging Het
Mfsd11 C A 11: 116,861,653 D209E probably benign Het
Muc1 C A 3: 89,231,118 F422L probably benign Het
Muc13 A G 16: 33,810,903 H391R probably benign Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Nfatc2ip T C 7: 126,387,445 Q346R probably damaging Het
Olfr971 A G 9: 39,840,304 Y290C probably damaging Het
Otol1 T A 3: 70,027,966 D430E probably damaging Het
Pcdh1 T C 18: 38,192,102 E929G probably damaging Het
Plekhf1 C T 7: 38,222,042 R34H probably damaging Het
Plekhm2 A T 4: 141,631,328 V622E probably benign Het
Pomt2 G A 12: 87,138,064 T196I probably damaging Het
Ppp1r12c C T 7: 4,484,704 G436D probably damaging Het
Prss50 A G 9: 110,858,013 probably benign Het
Slc29a1 A G 17: 45,589,476 I176T probably damaging Het
Slc5a9 A T 4: 111,898,593 V36E probably damaging Het
Slc7a1 A C 5: 148,348,283 S133R probably damaging Het
Sox17 A G 1: 4,491,850 Y376H probably benign Het
Spata4 T C 8: 54,609,900 I280T probably benign Het
Svop T A 5: 114,054,496 I187F probably damaging Het
Tas2r103 T A 6: 133,036,933 I57F Het
Tead3 A G 17: 28,332,730 V463A probably damaging Het
Tenm4 G C 7: 96,852,503 G1305R probably damaging Het
Tmem55a T C 4: 14,912,491 M200T possibly damaging Het
Top2a A T 11: 99,009,851 F594L probably damaging Het
Trim23 A G 13: 104,198,065 T419A possibly damaging Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Ttyh2 A G 11: 114,702,264 I254V probably benign Het
Vmn2r58 T C 7: 41,837,795 M559V probably benign Het
Wwp1 A T 4: 19,643,437 H358Q probably null Het
Zcwpw1 A C 5: 137,822,364 D597A probably damaging Het
Zfp318 A T 17: 46,399,835 Y828F probably damaging Het
Zfp608 T A 18: 54,899,122 N582I possibly damaging Het
Other mutations in Ism1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Ism1 APN 2 139757303 missense probably damaging 1.00
IGL02496:Ism1 APN 2 139757201 missense probably damaging 1.00
IGL03349:Ism1 APN 2 139731975 nonsense probably null
R0212:Ism1 UTSW 2 139740257 missense probably benign 0.00
R0312:Ism1 UTSW 2 139678672 start codon destroyed probably null 0.88
R1355:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1370:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1775:Ism1 UTSW 2 139746043 missense probably damaging 1.00
R1992:Ism1 UTSW 2 139746017 missense probably benign 0.01
R2021:Ism1 UTSW 2 139740127 splice site probably null
R2035:Ism1 UTSW 2 139757155 missense probably damaging 1.00
R2270:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R2271:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R3722:Ism1 UTSW 2 139732011 nonsense probably null
R3792:Ism1 UTSW 2 139740253 missense probably damaging 0.99
R4907:Ism1 UTSW 2 139678752 missense probably benign 0.27
R5621:Ism1 UTSW 2 139678721 missense probably damaging 0.99
R5964:Ism1 UTSW 2 139678757 missense probably benign
R6255:Ism1 UTSW 2 139746042 small deletion probably benign
R7009:Ism1 UTSW 2 139757279 missense probably damaging 1.00
R7325:Ism1 UTSW 2 139757043 missense probably damaging 1.00
R7851:Ism1 UTSW 2 139757265 missense probably damaging 1.00
R8958:Ism1 UTSW 2 139732075 missense possibly damaging 0.93
R9365:Ism1 UTSW 2 139740401 missense probably damaging 1.00
Z1176:Ism1 UTSW 2 139731874 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCAAGTTTCTACCCGAGAG -3'
(R):5'- TCCCACAGACGTGTCCTATG -3'

Sequencing Primer
(F):5'- AGGAGTAATGAAGACAAGAAGGC -3'
(R):5'- GACGTGTCCTATGTCTCAGTCTAG -3'
Posted On 2021-07-15