Mutagenetix > Incidental Mutation

Incidental Mutation 'R0730:Map1b'

67500

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

038911-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0730 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 99429766 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 2149 (S2149*)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

probably null
Transcript: ENSMUST00000064762
AA Change: S2149*

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: S2149*

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.8%
20x: 96.1%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,469,535	H509L	probably benign	Het
9930021J03Rik	T	A	19: 29,717,981	I1438F	probably benign	Het
Adam9	A	T	8: 24,996,758	I168N	probably benign	Het
Adamts20	G	A	15: 94,347,690	A577V	probably benign	Het
Agtr1a	A	T	13: 30,381,296	S115C	probably damaging	Het
Ankrd11	T	C	8: 122,891,953	Y1720C	probably damaging	Het
Ano6	A	T	15: 95,920,371	T353S	probably damaging	Het
App	A	G	16: 85,079,952	F184L	probably damaging	Het
Arhgef38	T	A	3: 133,137,471	Y446F	probably benign	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Atp1a4	G	A	1: 172,240,207		probably benign	Het
Bdp1	G	A	13: 100,058,951		probably benign	Het
Bicd2	T	A	13: 49,378,241	S246T	possibly damaging	Het
Bsn	T	A	9: 108,106,812	M3348L	unknown	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cacna2d3	T	C	14: 28,982,365	I820V	probably benign	Het
Cdc40	A	G	10: 40,844,956		probably benign	Het
Cdh23	T	C	10: 60,323,714	E2094G	probably damaging	Het
Celsr2	T	A	3: 108,398,606	N2061Y	probably damaging	Het
Cfap206	G	A	4: 34,711,391	A502V	probably benign	Het
Cfap54	T	C	10: 93,034,737	T29A	probably benign	Het
Cfap57	T	C	4: 118,612,920		probably null	Het
Chd5	A	G	4: 152,347,984	E43G	possibly damaging	Het
Clk1	G	A	1: 58,414,399	H343Y	probably benign	Het
Cntn4	A	C	6: 106,550,486	K443T	probably damaging	Het
Csn2	G	A	5: 87,694,952	A72V	possibly damaging	Het
Ctdp1	T	A	18: 80,450,242	H346L	probably benign	Het
Ctif	A	T	18: 75,565,012	N192K	probably damaging	Het
Ddr2	G	A	1: 169,995,566	A383V	probably benign	Het
Derl3	C	T	10: 75,895,242		probably benign	Het
Dgkh	T	C	14: 78,584,479	I865V	probably damaging	Het
Dip2b	C	T	15: 100,171,651	A619V	probably damaging	Het
Eml1	A	G	12: 108,530,326	T614A	possibly damaging	Het
Eogt	G	C	6: 97,116,009	Y402*	probably null	Het
Erbb4	A	G	1: 68,259,290	V647A	probably damaging	Het
Esm1	G	T	13: 113,213,502		probably null	Het
Fbxo31	A	G	8: 121,555,364		probably benign	Het
Fbxw5	T	A	2: 25,504,618	D201E	possibly damaging	Het
Fgfr1	G	A	8: 25,555,744	D123N	probably benign	Het
G530012D18Rik	A	C	1: 85,577,036		probably benign	Het
Gnat1	G	A	9: 107,679,463	T29I	probably damaging	Het
Gtf2ird2	A	T	5: 134,192,758	R67*	probably null	Het
Iltifb	A	T	10: 118,294,237	D87E	probably benign	Het
Kcnq3	T	C	15: 65,995,608	T729A	probably benign	Het
Klrc2	A	T	6: 129,658,696	S156R	probably damaging	Het
Krt76	A	T	15: 101,887,349	L462Q	probably damaging	Het
Lama3	C	A	18: 12,456,850		probably benign	Het
Lin28a	A	T	4: 134,008,008	S56T	probably damaging	Het
Macf1	A	G	4: 123,382,530		probably benign	Het
Macrod2	C	T	2: 142,217,674		probably benign	Het
Mansc1	C	T	6: 134,617,461		probably benign	Het
Mgst1	A	T	6: 138,147,669	T34S	probably benign	Het
Mlf2	C	T	6: 124,934,391	T123M	probably damaging	Het
Mospd2	C	T	X: 164,948,257		probably benign	Het
Mrpl15	A	T	1: 4,777,611	V155E	probably damaging	Het
Mstn	A	T	1: 53,061,794	Y10F	possibly damaging	Het
Myo1g	C	T	11: 6,520,794	V21M	probably damaging	Het
Myom2	T	C	8: 15,099,326	I599T	probably benign	Het
Ndc80	A	T	17: 71,496,246	N633K	probably benign	Het
Nhs	C	A	X: 161,837,300	V1487L	possibly damaging	Het
Npc1	T	C	18: 12,219,325	T106A	probably benign	Het
Nup133	C	T	8: 123,949,008	V57M	probably benign	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Olfr1045	A	G	2: 86,198,725	V9A	probably benign	Het
Olfr1106	T	C	2: 87,049,148	I29M	probably benign	Het
Olfr818	T	A	10: 129,945,111	H317L	probably benign	Het
Oprm1	T	C	10: 6,832,652		probably benign	Het
Ostf1	C	T	19: 18,604,207	V14I	unknown	Het
Pcdhb14	C	A	18: 37,448,868	D342E	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Pdpr	T	C	8: 111,125,755		probably null	Het
Plce1	G	A	19: 38,716,691	V847M	probably damaging	Het
Pon3	A	G	6: 5,230,444	M288T	probably benign	Het
Psd2	A	T	18: 35,978,574	D84V	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ralgapa1	T	C	12: 55,665,663	K1808E	probably damaging	Het
Ramp3	T	C	11: 6,676,476		probably benign	Het
Rasgrf1	T	A	9: 89,951,009		probably benign	Het
Rictor	A	G	15: 6,773,986		probably benign	Het
Rptor	A	T	11: 119,884,954	I984F	probably benign	Het
Slc1a6	C	T	10: 78,796,008	P223S	probably benign	Het
Taar8b	A	C	10: 24,092,026	V90G	probably damaging	Het
Tbc1d21	A	G	9: 58,359,877	V327A	probably benign	Het
Tex21	T	C	12: 76,204,166	T499A	probably benign	Het
Tg	A	T	15: 66,678,789	D256V	probably damaging	Het
Tmf1	A	G	6: 97,176,492	S207P	probably benign	Het
Tpr	A	G	1: 150,393,407		probably benign	Het
Ufd1	A	G	16: 18,814,887	T21A	probably damaging	Het
Unc13a	T	C	8: 71,656,285	D115G	possibly damaging	Het
Usb1	T	A	8: 95,344,041	F198L	probably damaging	Het
Utrn	A	T	10: 12,698,158		probably benign	Het
Vars	A	G	17: 35,014,300	N954S	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Wdr33	C	T	18: 31,835,376		probably benign	Het
Zfp236	A	G	18: 82,640,244		probably benign	Het
Zfp445	A	T	9: 122,861,758	V124E	probably damaging	Het
Zfp616	A	T	11: 74,084,822	H639L	probably damaging	Het
Zfyve16	C	A	13: 92,521,477	S642I	probably damaging	Het
Zswim5	C	T	4: 116,985,746	T896I	possibly damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AAAGGCTTGGACTTCCCATCACCC -3'
(R):5'- TGAGACCTCAGACCGATGCTACAC -3'

Sequencing Primer
(F):5'- CACCCTTTTTGACAGGTGAAG -3'
(R):5'- CACGCCAGGATGTTGATTTATG -3'

Posted On

2013-09-03