Incidental Mutation 'R8851:Tas2r103'
ID 675000
Institutional Source Beutler Lab
Gene Symbol Tas2r103
Ensembl Gene ENSMUSG00000030196
Gene Name taste receptor, type 2, member 103
Synonyms mt2r63, T2R3, Tas2r10, EG667992, mGR03, TRB2, Tas2r3
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8851 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 133036163-133037101 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 133036933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 57 (I57F)
Ref Sequence ENSEMBL: ENSMUSP00000032317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032317]
AlphaFold Q9JKA3
Predicted Effect
SMART Domains Protein: ENSMUSP00000032317
Gene: ENSMUSG00000030196
AA Change: I57F

DomainStartEndE-ValueType
Pfam:TAS2R 5 301 1.5e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,116 I279F probably benign Het
Adamts7 A G 9: 90,193,110 N965S probably benign Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankar T C 1: 72,652,376 Y1142C probably damaging Het
Apoa4 A G 9: 46,242,608 K169R probably benign Het
AY761184 T A 8: 21,703,539 I22F possibly damaging Het
Cd22 T A 7: 30,877,659 K74N probably benign Het
Dgcr2 G A 16: 17,872,643 T41I possibly damaging Het
Dicer1 A G 12: 104,724,041 V245A possibly damaging Het
Dopey2 T A 16: 93,762,510 S715T probably benign Het
Epb41l1 A T 2: 156,522,511 H980L probably benign Het
Erc2 A T 14: 28,317,259 E973V probably null Het
Fam124b T A 1: 80,213,165 Q167L probably damaging Het
Frmpd2 A G 14: 33,495,686 E46G probably damaging Het
Gabrb2 G A 11: 42,421,359 V4I probably benign Het
Gbf1 T A 19: 46,268,483 N841K probably damaging Het
Gnpat A G 8: 124,874,265 H161R probably damaging Het
Gpd2 A T 2: 57,307,050 M206L possibly damaging Het
Grid2ip T C 5: 143,362,597 F148L possibly damaging Het
Hemk1 A G 9: 107,336,213 V128A probably benign Het
Ism1 G T 2: 139,749,545 S273I probably damaging Het
Kcnab3 G T 11: 69,328,164 probably null Het
Kdm6b A G 11: 69,401,167 Y1430H unknown Het
Lama2 A G 10: 27,366,123 V279A possibly damaging Het
Lmf1 G A 17: 25,585,706 W119* probably null Het
Lrrc42 A G 4: 107,239,178 V276A probably benign Het
Magi2 T C 5: 20,065,620 F163L probably damaging Het
Map2k2 A G 10: 81,119,263 K196R probably damaging Het
Mfsd11 C A 11: 116,861,653 D209E probably benign Het
Muc1 C A 3: 89,231,118 F422L probably benign Het
Muc13 A G 16: 33,810,903 H391R probably benign Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Nfatc2ip T C 7: 126,387,445 Q346R probably damaging Het
Olfr971 A G 9: 39,840,304 Y290C probably damaging Het
Otol1 T A 3: 70,027,966 D430E probably damaging Het
Pcdh1 T C 18: 38,192,102 E929G probably damaging Het
Plekhf1 C T 7: 38,222,042 R34H probably damaging Het
Plekhm2 A T 4: 141,631,328 V622E probably benign Het
Pomt2 G A 12: 87,138,064 T196I probably damaging Het
Ppp1r12c C T 7: 4,484,704 G436D probably damaging Het
Prss50 A G 9: 110,858,013 probably benign Het
Slc29a1 A G 17: 45,589,476 I176T probably damaging Het
Slc5a9 A T 4: 111,898,593 V36E probably damaging Het
Slc7a1 A C 5: 148,348,283 S133R probably damaging Het
Sox17 A G 1: 4,491,850 Y376H probably benign Het
Spata4 T C 8: 54,609,900 I280T probably benign Het
Svop T A 5: 114,054,496 I187F probably damaging Het
Tead3 A G 17: 28,332,730 V463A probably damaging Het
Tenm4 G C 7: 96,852,503 G1305R probably damaging Het
Tmem55a T C 4: 14,912,491 M200T possibly damaging Het
Top2a A T 11: 99,009,851 F594L probably damaging Het
Trim23 A G 13: 104,198,065 T419A possibly damaging Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Ttyh2 A G 11: 114,702,264 I254V probably benign Het
Vmn2r58 T C 7: 41,837,795 M559V probably benign Het
Wwp1 A T 4: 19,643,437 H358Q probably null Het
Zcwpw1 A C 5: 137,822,364 D597A probably damaging Het
Zfp318 A T 17: 46,399,835 Y828F probably damaging Het
Zfp608 T A 18: 54,899,122 N582I possibly damaging Het
Other mutations in Tas2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Tas2r103 APN 6 133037056 missense possibly damaging 0.86
IGL02332:Tas2r103 APN 6 133036512 missense probably benign 0.21
IGL03122:Tas2r103 APN 6 133036909 missense probably damaging 1.00
IGL03167:Tas2r103 APN 6 133036660 missense probably damaging 0.98
R0380:Tas2r103 UTSW 6 133036203 missense probably damaging 1.00
R0671:Tas2r103 UTSW 6 133036350 missense probably benign 0.01
R1700:Tas2r103 UTSW 6 133036811 missense probably damaging 1.00
R2098:Tas2r103 UTSW 6 133036597 missense probably benign
R3977:Tas2r103 UTSW 6 133036317 missense probably benign 0.16
R3979:Tas2r103 UTSW 6 133036317 missense probably benign 0.16
R3980:Tas2r103 UTSW 6 133036317 missense probably benign 0.16
R4924:Tas2r103 UTSW 6 133036198 missense probably benign 0.02
R5779:Tas2r103 UTSW 6 133036945 missense probably benign 0.02
R5839:Tas2r103 UTSW 6 133036816 missense probably benign 0.06
R6265:Tas2r103 UTSW 6 133036531 missense probably damaging 1.00
R7768:Tas2r103 UTSW 6 133036849 missense probably benign 0.06
R9435:Tas2r103 UTSW 6 133036723 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTCCCATTTGAGAACAAGG -3'
(R):5'- ACACAGCCGTCTAGAAGATTG -3'

Sequencing Primer
(F):5'- TCCCATTTGAGAACAAGGAAAATAG -3'
(R):5'- GCCGTCTAGAAGATTGTATTAACAC -3'
Posted On 2021-07-15