Incidental Mutation 'R8851:Erc2'
ID 675026
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene Name ELKS/RAB6-interacting/CAST family member 2
Synonyms D14Ertd171e, ELKS2alpha, CAST
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8851 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 27344385-28200494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28039216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 973 (E973V)
Ref Sequence ENSEMBL: ENSMUSP00000147981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]
AlphaFold Q6PH08
Predicted Effect probably benign
Transcript: ENSMUST00000090302
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000210135
AA Change: E973V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210924
AA Change: E619V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211145
AA Change: E953V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,683 (GRCm39) I279F probably benign Het
Adamts7 A G 9: 90,075,163 (GRCm39) N965S probably benign Het
Adgrl3 A G 5: 81,613,119 (GRCm39) Y184C probably damaging Het
Ankar T C 1: 72,691,535 (GRCm39) Y1142C probably damaging Het
Apoa4 A G 9: 46,153,906 (GRCm39) K169R probably benign Het
Cd22 T A 7: 30,577,084 (GRCm39) K74N probably benign Het
Defa39 T A 8: 22,193,555 (GRCm39) I22F possibly damaging Het
Dgcr2 G A 16: 17,690,507 (GRCm39) T41I possibly damaging Het
Dicer1 A G 12: 104,690,300 (GRCm39) V245A possibly damaging Het
Dop1b T A 16: 93,559,398 (GRCm39) S715T probably benign Het
Epb41l1 A T 2: 156,364,431 (GRCm39) H980L probably benign Het
Fam124b T A 1: 80,190,882 (GRCm39) Q167L probably damaging Het
Frmpd2 A G 14: 33,217,643 (GRCm39) E46G probably damaging Het
Gabrb2 G A 11: 42,312,186 (GRCm39) V4I probably benign Het
Gbf1 T A 19: 46,256,922 (GRCm39) N841K probably damaging Het
Gnpat A G 8: 125,601,004 (GRCm39) H161R probably damaging Het
Gpd2 A T 2: 57,197,062 (GRCm39) M206L possibly damaging Het
Grid2ip T C 5: 143,348,352 (GRCm39) F148L possibly damaging Het
Hemk1 A G 9: 107,213,412 (GRCm39) V128A probably benign Het
Ism1 G T 2: 139,591,465 (GRCm39) S273I probably damaging Het
Kcnab3 G T 11: 69,218,990 (GRCm39) probably null Het
Kdm6b A G 11: 69,291,993 (GRCm39) Y1430H unknown Het
Lama2 A G 10: 27,242,119 (GRCm39) V279A possibly damaging Het
Lmf1 G A 17: 25,804,680 (GRCm39) W119* probably null Het
Lrrc42 A G 4: 107,096,375 (GRCm39) V276A probably benign Het
Magi2 T C 5: 20,270,618 (GRCm39) F163L probably damaging Het
Map2k2 A G 10: 80,955,097 (GRCm39) K196R probably damaging Het
Mfsd11 C A 11: 116,752,479 (GRCm39) D209E probably benign Het
Muc1 C A 3: 89,138,425 (GRCm39) F422L probably benign Het
Muc13 A G 16: 33,631,273 (GRCm39) H391R probably benign Het
Mxi1 G A 19: 53,360,126 (GRCm39) G283S probably damaging Het
Nfatc2ip T C 7: 125,986,617 (GRCm39) Q346R probably damaging Het
Or8g2b A G 9: 39,751,600 (GRCm39) Y290C probably damaging Het
Otol1 T A 3: 69,935,299 (GRCm39) D430E probably damaging Het
Pcdh1 T C 18: 38,325,155 (GRCm39) E929G probably damaging Het
Pip4p2 T C 4: 14,912,491 (GRCm39) M200T possibly damaging Het
Plekhf1 C T 7: 37,921,466 (GRCm39) R34H probably damaging Het
Plekhm2 A T 4: 141,358,639 (GRCm39) V622E probably benign Het
Pomt2 G A 12: 87,184,838 (GRCm39) T196I probably damaging Het
Ppp1r12c C T 7: 4,487,703 (GRCm39) G436D probably damaging Het
Prss50 A G 9: 110,687,081 (GRCm39) probably benign Het
Slc29a1 A G 17: 45,900,402 (GRCm39) I176T probably damaging Het
Slc5a9 A T 4: 111,755,790 (GRCm39) V36E probably damaging Het
Slc7a1 A C 5: 148,285,093 (GRCm39) S133R probably damaging Het
Sox17 A G 1: 4,562,073 (GRCm39) Y376H probably benign Het
Spata4 T C 8: 55,062,935 (GRCm39) I280T probably benign Het
Svop T A 5: 114,192,557 (GRCm39) I187F probably damaging Het
Tas2r103 T A 6: 133,013,896 (GRCm39) I57F Het
Tead3 A G 17: 28,551,704 (GRCm39) V463A probably damaging Het
Tenm4 G C 7: 96,501,710 (GRCm39) G1305R probably damaging Het
Top2a A T 11: 98,900,677 (GRCm39) F594L probably damaging Het
Trim23 A G 13: 104,334,573 (GRCm39) T419A possibly damaging Het
Ttn T C 2: 76,629,237 (GRCm39) E12621G probably damaging Het
Ttyh2 A G 11: 114,593,090 (GRCm39) I254V probably benign Het
Vmn2r58 T C 7: 41,487,219 (GRCm39) M559V probably benign Het
Wwp1 A T 4: 19,643,437 (GRCm39) H358Q probably null Het
Zcwpw1 A C 5: 137,820,626 (GRCm39) D597A probably damaging Het
Zfp318 A T 17: 46,710,761 (GRCm39) Y828F probably damaging Het
Zfp608 T A 18: 55,032,194 (GRCm39) N582I possibly damaging Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 27,762,478 (GRCm39) missense probably damaging 0.98
IGL01862:Erc2 APN 14 27,993,526 (GRCm39) splice site probably benign
IGL01906:Erc2 APN 14 27,863,263 (GRCm39) missense probably damaging 0.99
IGL02177:Erc2 APN 14 27,620,580 (GRCm39) missense probably benign 0.00
IGL02481:Erc2 APN 14 27,375,028 (GRCm39) missense probably damaging 1.00
IGL02483:Erc2 APN 14 27,375,028 (GRCm39) missense probably damaging 1.00
IGL02623:Erc2 APN 14 27,498,937 (GRCm39) missense probably damaging 1.00
IGL03252:Erc2 APN 14 28,197,606 (GRCm39) utr 3 prime probably benign
IGL03378:Erc2 APN 14 27,733,680 (GRCm39) missense probably damaging 1.00
lobe UTSW 14 28,039,208 (GRCm39) missense probably damaging 0.96
R0091:Erc2 UTSW 14 27,498,781 (GRCm39) critical splice acceptor site probably null
R0309:Erc2 UTSW 14 27,863,182 (GRCm39) missense probably damaging 0.98
R0357:Erc2 UTSW 14 27,498,979 (GRCm39) missense probably damaging 0.99
R0378:Erc2 UTSW 14 27,733,651 (GRCm39) missense probably damaging 1.00
R0550:Erc2 UTSW 14 27,993,608 (GRCm39) missense possibly damaging 0.74
R0815:Erc2 UTSW 14 27,747,105 (GRCm39) missense probably benign 0.04
R0863:Erc2 UTSW 14 27,747,105 (GRCm39) missense probably benign 0.04
R1121:Erc2 UTSW 14 28,197,612 (GRCm39) utr 3 prime probably benign
R1164:Erc2 UTSW 14 28,024,929 (GRCm39) missense probably damaging 0.99
R1498:Erc2 UTSW 14 28,024,855 (GRCm39) missense probably benign 0.27
R1500:Erc2 UTSW 14 27,993,617 (GRCm39) missense probably damaging 0.98
R1555:Erc2 UTSW 14 27,733,622 (GRCm39) missense probably damaging 0.99
R1894:Erc2 UTSW 14 27,863,185 (GRCm39) missense probably damaging 0.99
R1950:Erc2 UTSW 14 27,634,857 (GRCm39) missense probably damaging 0.99
R1991:Erc2 UTSW 14 27,733,593 (GRCm39) missense probably benign 0.34
R2698:Erc2 UTSW 14 27,993,662 (GRCm39) missense probably benign 0.06
R2847:Erc2 UTSW 14 27,762,445 (GRCm39) missense probably damaging 0.97
R3015:Erc2 UTSW 14 27,733,732 (GRCm39) critical splice donor site probably null
R3612:Erc2 UTSW 14 27,499,134 (GRCm39) missense possibly damaging 0.69
R3759:Erc2 UTSW 14 27,747,120 (GRCm39) missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R3858:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R3859:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R4556:Erc2 UTSW 14 28,024,861 (GRCm39) missense probably damaging 1.00
R4739:Erc2 UTSW 14 27,498,838 (GRCm39) missense probably damaging 1.00
R4898:Erc2 UTSW 14 27,375,285 (GRCm39) missense probably damaging 1.00
R5068:Erc2 UTSW 14 28,024,900 (GRCm39) missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27,374,829 (GRCm39) missense probably benign 0.40
R5418:Erc2 UTSW 14 27,688,467 (GRCm39) missense probably benign 0.14
R5741:Erc2 UTSW 14 28,024,826 (GRCm39) splice site probably null
R5819:Erc2 UTSW 14 27,863,326 (GRCm39) missense probably damaging 0.97
R5930:Erc2 UTSW 14 27,498,815 (GRCm39) missense probably damaging 0.99
R6073:Erc2 UTSW 14 27,733,593 (GRCm39) missense probably benign 0.00
R6150:Erc2 UTSW 14 27,863,248 (GRCm39) missense probably damaging 0.97
R6182:Erc2 UTSW 14 28,039,210 (GRCm39) missense probably damaging 0.99
R6188:Erc2 UTSW 14 28,039,208 (GRCm39) missense probably damaging 0.96
R6267:Erc2 UTSW 14 27,802,112 (GRCm39) missense probably damaging 1.00
R6296:Erc2 UTSW 14 27,802,112 (GRCm39) missense probably damaging 1.00
R6730:Erc2 UTSW 14 27,620,524 (GRCm39) missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27,620,553 (GRCm39) missense probably damaging 1.00
R7095:Erc2 UTSW 14 27,620,550 (GRCm39) missense probably damaging 0.99
R7221:Erc2 UTSW 14 27,375,115 (GRCm39) missense probably damaging 0.97
R7365:Erc2 UTSW 14 27,762,346 (GRCm39) missense probably damaging 1.00
R7454:Erc2 UTSW 14 28,024,948 (GRCm39) missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27,598,161 (GRCm39) critical splice donor site probably null
R7784:Erc2 UTSW 14 27,620,551 (GRCm39) missense probably damaging 0.96
R7890:Erc2 UTSW 14 27,762,298 (GRCm39) critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27,499,165 (GRCm39) missense probably damaging 1.00
R8031:Erc2 UTSW 14 27,733,649 (GRCm39) missense probably damaging 0.99
R8206:Erc2 UTSW 14 28,024,972 (GRCm39) splice site probably null
R8273:Erc2 UTSW 14 27,499,096 (GRCm39) missense probably benign 0.41
R8304:Erc2 UTSW 14 27,375,122 (GRCm39) missense probably damaging 0.99
R8387:Erc2 UTSW 14 27,375,253 (GRCm39) missense possibly damaging 0.92
R8751:Erc2 UTSW 14 27,802,145 (GRCm39) missense possibly damaging 0.78
R9130:Erc2 UTSW 14 27,751,418 (GRCm39) missense probably benign 0.25
R9292:Erc2 UTSW 14 27,498,799 (GRCm39) missense probably damaging 1.00
R9441:Erc2 UTSW 14 27,802,114 (GRCm39) missense possibly damaging 0.58
R9452:Erc2 UTSW 14 27,733,690 (GRCm39) missense probably damaging 1.00
R9529:Erc2 UTSW 14 28,197,723 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TATGCATTTGACAAGCCAGTG -3'
(R):5'- TGGGACACAGTAGCAAGCAC -3'

Sequencing Primer
(F):5'- CATTTGACAAGCCAGTGATGTG -3'
(R):5'- TCACAAACATCAGCGAGCACAATTG -3'
Posted On 2021-07-15