Incidental Mutation 'R8851:Gbf1'
ID 675037
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Name golgi-specific brefeldin A-resistance factor 1
Synonyms 1700083E03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8851 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46152509-46286510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46268483 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 841 (N841K)
Ref Sequence ENSEMBL: ENSMUSP00000026254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]
AlphaFold Q6DFZ1
Predicted Effect probably damaging
Transcript: ENSMUST00000026254
AA Change: N841K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: N841K

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176992
AA Change: N787K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: N787K

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177512
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,116 I279F probably benign Het
Adamts7 A G 9: 90,193,110 N965S probably benign Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankar T C 1: 72,652,376 Y1142C probably damaging Het
Apoa4 A G 9: 46,242,608 K169R probably benign Het
AY761184 T A 8: 21,703,539 I22F possibly damaging Het
Cd22 T A 7: 30,877,659 K74N probably benign Het
Dgcr2 G A 16: 17,872,643 T41I possibly damaging Het
Dicer1 A G 12: 104,724,041 V245A possibly damaging Het
Dopey2 T A 16: 93,762,510 S715T probably benign Het
Epb41l1 A T 2: 156,522,511 H980L probably benign Het
Erc2 A T 14: 28,317,259 E973V probably null Het
Fam124b T A 1: 80,213,165 Q167L probably damaging Het
Frmpd2 A G 14: 33,495,686 E46G probably damaging Het
Gabrb2 G A 11: 42,421,359 V4I probably benign Het
Gnpat A G 8: 124,874,265 H161R probably damaging Het
Gpd2 A T 2: 57,307,050 M206L possibly damaging Het
Grid2ip T C 5: 143,362,597 F148L possibly damaging Het
Hemk1 A G 9: 107,336,213 V128A probably benign Het
Ism1 G T 2: 139,749,545 S273I probably damaging Het
Kcnab3 G T 11: 69,328,164 probably null Het
Kdm6b A G 11: 69,401,167 Y1430H unknown Het
Lama2 A G 10: 27,366,123 V279A possibly damaging Het
Lmf1 G A 17: 25,585,706 W119* probably null Het
Lrrc42 A G 4: 107,239,178 V276A probably benign Het
Magi2 T C 5: 20,065,620 F163L probably damaging Het
Map2k2 A G 10: 81,119,263 K196R probably damaging Het
Mfsd11 C A 11: 116,861,653 D209E probably benign Het
Muc1 C A 3: 89,231,118 F422L probably benign Het
Muc13 A G 16: 33,810,903 H391R probably benign Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Nfatc2ip T C 7: 126,387,445 Q346R probably damaging Het
Olfr971 A G 9: 39,840,304 Y290C probably damaging Het
Otol1 T A 3: 70,027,966 D430E probably damaging Het
Pcdh1 T C 18: 38,192,102 E929G probably damaging Het
Plekhf1 C T 7: 38,222,042 R34H probably damaging Het
Plekhm2 A T 4: 141,631,328 V622E probably benign Het
Pomt2 G A 12: 87,138,064 T196I probably damaging Het
Ppp1r12c C T 7: 4,484,704 G436D probably damaging Het
Prss50 A G 9: 110,858,013 probably benign Het
Slc29a1 A G 17: 45,589,476 I176T probably damaging Het
Slc5a9 A T 4: 111,898,593 V36E probably damaging Het
Slc7a1 A C 5: 148,348,283 S133R probably damaging Het
Sox17 A G 1: 4,491,850 Y376H probably benign Het
Spata4 T C 8: 54,609,900 I280T probably benign Het
Svop T A 5: 114,054,496 I187F probably damaging Het
Tas2r103 T A 6: 133,036,933 I57F Het
Tead3 A G 17: 28,332,730 V463A probably damaging Het
Tenm4 G C 7: 96,852,503 G1305R probably damaging Het
Tmem55a T C 4: 14,912,491 M200T possibly damaging Het
Top2a A T 11: 99,009,851 F594L probably damaging Het
Trim23 A G 13: 104,198,065 T419A possibly damaging Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Ttyh2 A G 11: 114,702,264 I254V probably benign Het
Vmn2r58 T C 7: 41,837,795 M559V probably benign Het
Wwp1 A T 4: 19,643,437 H358Q probably null Het
Zcwpw1 A C 5: 137,822,364 D597A probably damaging Het
Zfp318 A T 17: 46,399,835 Y828F probably damaging Het
Zfp608 T A 18: 54,899,122 N582I possibly damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
R8716:Gbf1 UTSW 19 46284021 missense probably damaging 1.00
R9424:Gbf1 UTSW 19 46259683 missense probably benign 0.00
R9435:Gbf1 UTSW 19 46279993 missense probably benign 0.42
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGAAGTTCACCCCTTGTATAC -3'
(R):5'- GTGAAAGAACCCCTTCTCCATC -3'

Sequencing Primer
(F):5'- TACCAACTCTGTATACCAGTGGG -3'
(R):5'- ATCCCAGTCCTTCTTCTGAATTGG -3'
Posted On 2021-07-15