Mutagenetix > Incidental Mutations

Incidental Mutation 'R8851:Gbf1'

675037

Institutional Source

Beutler Lab

Gene Symbol

Gbf1

Ensembl Gene

ENSMUSG00000025224

Gene Name

golgi-specific brefeldin A-resistance factor 1

Synonyms

1700083E03Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8851 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46152509-46286510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46268483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 841 (N841K)

Ref Sequence

ENSEMBL: ENSMUSP00000026254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]

AlphaFold

Q6DFZ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000026254
AA Change: N841K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: N841K

Domain	Start	End	E-Value	Type
low complexity region	270	288	N/A	INTRINSIC
Pfam:Sec7_N	400	551	3.4e-29	PFAM
Sec7	696	884	8.55e-91	SMART
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1773	1793	N/A	INTRINSIC
low complexity region	1802	1820	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176992
AA Change: N787K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: N787K

Domain	Start	End	E-Value	Type
low complexity region	216	234	N/A	INTRINSIC
Pfam:Sec7_N	343	498	1.5e-35	PFAM
Sec7	642	830	8.55e-91	SMART
low complexity region	1144	1162	N/A	INTRINSIC
low complexity region	1227	1242	N/A	INTRINSIC
low complexity region	1715	1735	N/A	INTRINSIC
low complexity region	1744	1762	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177512

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr1	T	A	1: 173,332,116	I279F	probably benign	Het
Adamts7	A	G	9: 90,193,110	N965S	probably benign	Het
Adgrl3	A	G	5: 81,465,272	Y184C	probably damaging	Het
Ankar	T	C	1: 72,652,376	Y1142C	probably damaging	Het
Apoa4	A	G	9: 46,242,608	K169R	probably benign	Het
AY761184	T	A	8: 21,703,539	I22F	possibly damaging	Het
Cd22	T	A	7: 30,877,659	K74N	probably benign	Het
Dgcr2	G	A	16: 17,872,643	T41I	possibly damaging	Het
Dicer1	A	G	12: 104,724,041	V245A	possibly damaging	Het
Dopey2	T	A	16: 93,762,510	S715T	probably benign	Het
Epb41l1	A	T	2: 156,522,511	H980L	probably benign	Het
Erc2	A	T	14: 28,317,259	E973V	probably null	Het
Fam124b	T	A	1: 80,213,165	Q167L	probably damaging	Het
Frmpd2	A	G	14: 33,495,686	E46G	probably damaging	Het
Gabrb2	G	A	11: 42,421,359	V4I	probably benign	Het
Gnpat	A	G	8: 124,874,265	H161R	probably damaging	Het
Gpd2	A	T	2: 57,307,050	M206L	possibly damaging	Het
Grid2ip	T	C	5: 143,362,597	F148L	possibly damaging	Het
Hemk1	A	G	9: 107,336,213	V128A	probably benign	Het
Ism1	G	T	2: 139,749,545	S273I	probably damaging	Het
Kcnab3	G	T	11: 69,328,164		probably null	Het
Kdm6b	A	G	11: 69,401,167	Y1430H	unknown	Het
Lama2	A	G	10: 27,366,123	V279A	possibly damaging	Het
Lmf1	G	A	17: 25,585,706	W119*	probably null	Het
Lrrc42	A	G	4: 107,239,178	V276A	probably benign	Het
Magi2	T	C	5: 20,065,620	F163L	probably damaging	Het
Map2k2	A	G	10: 81,119,263	K196R	probably damaging	Het
Mfsd11	C	A	11: 116,861,653	D209E	probably benign	Het
Muc1	C	A	3: 89,231,118	F422L	probably benign	Het
Muc13	A	G	16: 33,810,903	H391R	probably benign	Het
Mxi1	G	A	19: 53,371,695	G283S	probably damaging	Het
Nfatc2ip	T	C	7: 126,387,445	Q346R	probably damaging	Het
Olfr971	A	G	9: 39,840,304	Y290C	probably damaging	Het
Otol1	T	A	3: 70,027,966	D430E	probably damaging	Het
Pcdh1	T	C	18: 38,192,102	E929G	probably damaging	Het
Plekhf1	C	T	7: 38,222,042	R34H	probably damaging	Het
Plekhm2	A	T	4: 141,631,328	V622E	probably benign	Het
Pomt2	G	A	12: 87,138,064	T196I	probably damaging	Het
Ppp1r12c	C	T	7: 4,484,704	G436D	probably damaging	Het
Prss50	A	G	9: 110,858,013		probably benign	Het
Slc29a1	A	G	17: 45,589,476	I176T	probably damaging	Het
Slc5a9	A	T	4: 111,898,593	V36E	probably damaging	Het
Slc7a1	A	C	5: 148,348,283	S133R	probably damaging	Het
Sox17	A	G	1: 4,491,850	Y376H	probably benign	Het
Spata4	T	C	8: 54,609,900	I280T	probably benign	Het
Svop	T	A	5: 114,054,496	I187F	probably damaging	Het
Tas2r103	T	A	6: 133,036,933	I57F		Het
Tead3	A	G	17: 28,332,730	V463A	probably damaging	Het
Tenm4	G	C	7: 96,852,503	G1305R	probably damaging	Het
Tmem55a	T	C	4: 14,912,491	M200T	possibly damaging	Het
Top2a	A	T	11: 99,009,851	F594L	probably damaging	Het
Trim23	A	G	13: 104,198,065	T419A	possibly damaging	Het
Ttn	T	C	2: 76,798,893	E12621G	probably damaging	Het
Ttyh2	A	G	11: 114,702,264	I254V	probably benign	Het
Vmn2r58	T	C	7: 41,837,795	M559V	probably benign	Het
Wwp1	A	T	4: 19,643,437	H358Q	probably null	Het
Zcwpw1	A	C	5: 137,822,364	D597A	probably damaging	Het
Zfp318	A	T	17: 46,399,835	Y828F	probably damaging	Het
Zfp608	T	A	18: 54,899,122	N582I	possibly damaging	Het

Other mutations in Gbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Gbf1	APN	19	46284249	critical splice acceptor site	probably null
IGL00988:Gbf1	APN	19	46284120	critical splice donor site	probably null
IGL01352:Gbf1	APN	19	46265215	missense	probably damaging	1.00
IGL01432:Gbf1	APN	19	46279995	missense	probably damaging	1.00
IGL01469:Gbf1	APN	19	46279364	missense	probably damaging	1.00
IGL01870:Gbf1	APN	19	46285669	missense	probably benign	0.00
IGL02019:Gbf1	APN	19	46279292	missense	possibly damaging	0.93
IGL02061:Gbf1	APN	19	46279258	missense	possibly damaging	0.65
IGL02126:Gbf1	APN	19	46252117	missense	probably damaging	0.97
IGL02272:Gbf1	APN	19	46269803	missense	probably damaging	1.00
IGL02346:Gbf1	APN	19	46285930	missense	probably damaging	1.00
IGL02491:Gbf1	APN	19	46262540	unclassified	probably benign
IGL03003:Gbf1	APN	19	46255655	missense	probably damaging	1.00
IGL03130:Gbf1	APN	19	46267348	missense	possibly damaging	0.82
IGL03376:Gbf1	APN	19	46262521	missense	possibly damaging	0.94
PIT4651001:Gbf1	UTSW	19	46163543	missense	probably benign
R0107:Gbf1	UTSW	19	46284828	missense	probably benign
R0139:Gbf1	UTSW	19	46261792	missense	probably damaging	1.00
R0180:Gbf1	UTSW	19	46285722	missense	probably benign
R0255:Gbf1	UTSW	19	46254110	splice site	probably benign
R0317:Gbf1	UTSW	19	46254020	missense	probably benign
R0329:Gbf1	UTSW	19	46272270	critical splice donor site	probably null
R0372:Gbf1	UTSW	19	46285704	missense	probably benign
R0666:Gbf1	UTSW	19	46262544	unclassified	probably benign
R1463:Gbf1	UTSW	19	46271545	unclassified	probably benign
R1701:Gbf1	UTSW	19	46261675	missense	probably damaging	1.00
R1848:Gbf1	UTSW	19	46272037	missense	possibly damaging	0.90
R1962:Gbf1	UTSW	19	46267219	missense	probably damaging	1.00
R1965:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R1966:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R2177:Gbf1	UTSW	19	46265670	missense	probably benign
R2238:Gbf1	UTSW	19	46163618	missense	probably benign
R2239:Gbf1	UTSW	19	46163618	missense	probably benign
R2520:Gbf1	UTSW	19	46265367	missense	probably benign
R3821:Gbf1	UTSW	19	46264807	missense	probably damaging	0.99
R4681:Gbf1	UTSW	19	46280550	missense	probably benign	0.41
R4695:Gbf1	UTSW	19	46259167	nonsense	probably null
R4785:Gbf1	UTSW	19	46268395	missense	possibly damaging	0.89
R5202:Gbf1	UTSW	19	46268454	missense	probably benign	0.13
R5359:Gbf1	UTSW	19	46283725	critical splice donor site	probably null
R5468:Gbf1	UTSW	19	46284296	missense	possibly damaging	0.92
R5593:Gbf1	UTSW	19	46272524	missense	possibly damaging	0.91
R5595:Gbf1	UTSW	19	46284422	missense	possibly damaging	0.74
R5796:Gbf1	UTSW	19	46284343	missense	probably benign	0.08
R5938:Gbf1	UTSW	19	46268452	missense	probably damaging	1.00
R5957:Gbf1	UTSW	19	46246221	critical splice donor site	probably null
R6059:Gbf1	UTSW	19	46265248	missense	probably damaging	1.00
R6120:Gbf1	UTSW	19	46279321	missense	possibly damaging	0.83
R6239:Gbf1	UTSW	19	46259696	missense	probably benign	0.00
R6252:Gbf1	UTSW	19	46271556	missense	probably benign	0.33
R6310:Gbf1	UTSW	19	46280005	missense	probably damaging	0.96
R6787:Gbf1	UTSW	19	46271772	missense	probably benign
R6805:Gbf1	UTSW	19	46262507	missense	probably damaging	1.00
R6855:Gbf1	UTSW	19	46279941	missense	probably benign	0.00
R7313:Gbf1	UTSW	19	46280354	missense	possibly damaging	0.94
R7414:Gbf1	UTSW	19	46283358	nonsense	probably null
R7646:Gbf1	UTSW	19	46283672	missense	probably damaging	1.00
R7650:Gbf1	UTSW	19	46272539	missense	probably damaging	1.00
R7789:Gbf1	UTSW	19	46254002	missense	probably damaging	1.00
R7801:Gbf1	UTSW	19	46272643	missense	probably benign	0.03
R8241:Gbf1	UTSW	19	46246137	missense	probably damaging	1.00
R8716:Gbf1	UTSW	19	46284021	missense	probably damaging	1.00
R9424:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9435:Gbf1	UTSW	19	46279993	missense	probably benign	0.42
Z1177:Gbf1	UTSW	19	46259142	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGGAAGTTCACCCCTTGTATAC -3'
(R):5'- GTGAAAGAACCCCTTCTCCATC -3'

Sequencing Primer
(F):5'- TACCAACTCTGTATACCAGTGGG -3'
(R):5'- ATCCCAGTCCTTCTTCTGAATTGG -3'

Posted On

2021-07-15