Mutagenetix > Incidental Mutation

Incidental Mutation 'R8852:Miip'

675048

Institutional Source

Beutler Lab

Gene Symbol

Miip

Ensembl Gene

ENSMUSG00000029022

Gene Name

migration and invasion inhibitory protein

Synonyms

D4Wsu114e

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R8852 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

147860778-147868816 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

T to A at 147866382 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000094481] [ENSMUST00000119975] [ENSMUST00000172710]

AlphaFold

A2A7Y5

Predicted Effect

probably benign
Transcript: ENSMUST00000030886

SMART Domains

Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	60	69	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094481

SMART Domains

Protein: ENSMUSP00000092054
Gene: ENSMUSG00000070583

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
coiled coil region	86	116	N/A	INTRINSIC
low complexity region	438	451	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119975

SMART Domains

Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
Pfam:MIIP	41	382	1.4e-142	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172710

SMART Domains

Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	60	69	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	G	12: 71,184,423	V985G	possibly damaging	Het
Acr	T	G	15: 89,573,854	M246R	probably damaging	Het
Adgrf5	G	T	17: 43,453,098	V1304L	possibly damaging	Het
Ago4	A	T	4: 126,493,250	D853E	probably benign	Het
Arvcf	C	A	16: 18,403,453	D790E	probably benign	Het
Atp8a2	A	C	14: 59,925,096	D725E	probably damaging	Het
C2cd5	A	G	6: 143,083,220	Y98H	probably benign	Het
Camkk2	T	C	5: 122,753,757	Y234C	probably damaging	Het
Ccdc106	A	G	7: 5,059,571	D192G	probably benign	Het
Ccm2l	T	C	2: 153,074,868	Y340H	probably damaging	Het
Chd1l	A	G	3: 97,570,369	F690S	probably benign	Het
Chuk	A	G	19: 44,087,968	S435P	possibly damaging	Het
Cisd3	T	A	11: 97,685,877	S10T	probably benign	Het
Cnppd1	A	G	1: 75,136,419	S402P	probably damaging	Het
Cped1	A	G	6: 22,215,621	D718G	probably damaging	Het
Crtc1	A	G	8: 70,388,155	S474P	probably damaging	Het
Dcpp3	G	T	17: 23,919,149	E94*	probably null	Het
Dhx38	A	T	8: 109,562,729	L13*	probably null	Het
Dmbt1	T	C	7: 131,041,123	Y120H	unknown	Het
Fntb	T	A	12: 76,888,052	V201E	possibly damaging	Het
Gga3	T	C	11: 115,590,418	D242G	probably benign	Het
Gsx2	T	C	5: 75,076,335	M192T	possibly damaging	Het
Hif3a	A	T	7: 17,040,987	M562K	probably benign	Het
Irf5	G	A	6: 29,535,998	R337H	probably damaging	Het
Kcnmb3	A	G	3: 32,472,475	V189A	possibly damaging	Het
Letmd1	A	G	15: 100,475,366	T241A	probably benign	Het
Lrrc14b	T	A	13: 74,361,289	D333V	probably damaging	Het
Meaf6	T	A	4: 125,086,197	L48Q	probably damaging	Het
Muc4	A	G	16: 32,750,643	T236A	possibly damaging	Het
Myh4	T	A	11: 67,241,509	I155N	probably damaging	Het
Obscn	C	T	11: 59,007,614	R6607Q	unknown	Het
Olfr110	G	A	17: 37,499,430	V260M	probably benign	Het
Olfr320	C	T	11: 58,684,140	T89I	probably benign	Het
Otof	T	C	5: 30,371,700	N1788S	possibly damaging	Het
Psapl1	T	C	5: 36,204,970	L302S	probably damaging	Het
Rdh8	A	C	9: 20,822,725	N69T	probably benign	Het
Ryr3	T	C	2: 112,794,499	E2212G	probably damaging	Het
Sept7	A	T	9: 25,252,684	N16Y	possibly damaging	Het
Slc22a17	A	T	14: 54,908,979	L60Q	probably damaging	Het
Snrnp200	T	C	2: 127,218,429	I531T	probably damaging	Het
Ssh3	A	T	19: 4,267,964	V41E	probably damaging	Het
Tars	G	T	15: 11,393,262	N115K	probably benign	Het
Tomm6	G	C	17: 47,687,925	F34L	possibly damaging	Het
Txnrd2	G	A	16: 18,440,851	V173M	possibly damaging	Het
Uba6	T	A	5: 86,141,595	I450F	possibly damaging	Het
Vmn2r95	G	T	17: 18,443,851	S516I	possibly damaging	Het
Vps4b	A	G	1: 106,782,684	F156L	possibly damaging	Het
Zfp354c	T	A	11: 50,815,192	H352L	probably damaging	Het
Zfp521	T	C	18: 13,939,093	D30G	probably benign	Het
Zic2	A	T	14: 122,476,118	H148L	possibly damaging	Het

Other mutations in Miip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Miip	APN	4	147865865	missense	probably damaging	1.00
IGL02134:Miip	APN	4	147865278	splice site	probably benign
IGL02829:Miip	APN	4	147863061	missense	probably benign	0.01
IGL03350:Miip	APN	4	147862522	missense	probably benign	0.01
R0200:Miip	UTSW	4	147862263	missense	probably damaging	0.99
R1647:Miip	UTSW	4	147865234	missense	probably benign	0.02
R1783:Miip	UTSW	4	147865774	missense	probably damaging	1.00
R1848:Miip	UTSW	4	147863092	missense	probably damaging	0.99
R1944:Miip	UTSW	4	147865965	missense	probably benign	0.15
R3615:Miip	UTSW	4	147865914	missense	probably benign	0.00
R3616:Miip	UTSW	4	147865914	missense	probably benign	0.00
R3882:Miip	UTSW	4	147861052	missense	possibly damaging	0.93
R4579:Miip	UTSW	4	147861061	missense	probably damaging	1.00
R5183:Miip	UTSW	4	147863069	missense	probably damaging	1.00
R6054:Miip	UTSW	4	147865678	missense	probably benign	0.00
R6056:Miip	UTSW	4	147862335	missense	probably damaging	1.00
R6304:Miip	UTSW	4	147863083	missense	probably benign	0.12
R6568:Miip	UTSW	4	147865915	missense	probably benign
R6603:Miip	UTSW	4	147865923	missense	possibly damaging	0.92
R7639:Miip	UTSW	4	147862564	missense	probably benign	0.22
R7701:Miip	UTSW	4	147862914	missense	probably null	0.86
R7795:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7796:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7797:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7872:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7920:Miip	UTSW	4	147862918	missense	probably benign	0.17
R8468:Miip	UTSW	4	147861471	missense	probably damaging	1.00
R8492:Miip	UTSW	4	147861424	missense	probably damaging	1.00
R8677:Miip	UTSW	4	147863046	missense	probably damaging	1.00
R8860:Miip	UTSW	4	147866382	start gained	probably benign
R9755:Miip	UTSW	4	147865862	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTTTGCACCGTCAATGAAATGG -3'
(R):5'- TCTCTTGGCAGGCAAGGAAG -3'

Sequencing Primer
(F):5'- CCGTCAATGAAATGGGTGCATCAC -3'
(R):5'- TGGCAGGCAAGGAAGCAGAG -3'

Posted On

2021-07-15