Incidental Mutation 'R8852:Miip'
ID675048
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Namemigration and invasion inhibitory protein
SynonymsD4Wsu114e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8852 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location147860778-147868816 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 147866382 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000094481] [ENSMUST00000119975] [ENSMUST00000172710]
Predicted Effect probably benign
Transcript: ENSMUST00000030886
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094481
SMART Domains Protein: ENSMUSP00000092054
Gene: ENSMUSG00000070583

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
coiled coil region 86 116 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119975
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172710
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,184,423 V985G possibly damaging Het
Acr T G 15: 89,573,854 M246R probably damaging Het
Adgrf5 G T 17: 43,453,098 V1304L possibly damaging Het
Ago4 A T 4: 126,493,250 D853E probably benign Het
Arvcf C A 16: 18,403,453 D790E probably benign Het
Atp8a2 A C 14: 59,925,096 D725E probably damaging Het
C2cd5 A G 6: 143,083,220 Y98H probably benign Het
Camkk2 T C 5: 122,753,757 Y234C probably damaging Het
Ccdc106 A G 7: 5,059,571 D192G probably benign Het
Ccm2l T C 2: 153,074,868 Y340H probably damaging Het
Chd1l A G 3: 97,570,369 F690S probably benign Het
Chuk A G 19: 44,087,968 S435P possibly damaging Het
Cisd3 T A 11: 97,685,877 S10T probably benign Het
Cnppd1 A G 1: 75,136,419 S402P probably damaging Het
Cped1 A G 6: 22,215,621 D718G probably damaging Het
Crtc1 A G 8: 70,388,155 S474P probably damaging Het
Dcpp3 G T 17: 23,919,149 E94* probably null Het
Dhx38 A T 8: 109,562,729 L13* probably null Het
Dmbt1 T C 7: 131,041,123 Y120H unknown Het
Fntb T A 12: 76,888,052 V201E possibly damaging Het
Gga3 T C 11: 115,590,418 D242G probably benign Het
Gsx2 T C 5: 75,076,335 M192T possibly damaging Het
Hif3a A T 7: 17,040,987 M562K probably benign Het
Irf5 G A 6: 29,535,998 R337H probably damaging Het
Kcnmb3 A G 3: 32,472,475 V189A possibly damaging Het
Letmd1 A G 15: 100,475,366 T241A probably benign Het
Lrrc14b T A 13: 74,361,289 D333V probably damaging Het
Meaf6 T A 4: 125,086,197 L48Q probably damaging Het
Muc4 A G 16: 32,750,643 T236A possibly damaging Het
Myh4 T A 11: 67,241,509 I155N probably damaging Het
Obscn C T 11: 59,007,614 R6607Q unknown Het
Olfr110 G A 17: 37,499,430 V260M probably benign Het
Olfr320 C T 11: 58,684,140 T89I probably benign Het
Otof T C 5: 30,371,700 N1788S possibly damaging Het
Psapl1 T C 5: 36,204,970 L302S probably damaging Het
Rdh8 A C 9: 20,822,725 N69T probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,915 probably benign Het
Ryr3 T C 2: 112,794,499 E2212G probably damaging Het
Sept7 A T 9: 25,252,684 N16Y possibly damaging Het
Slc22a17 A T 14: 54,908,979 L60Q probably damaging Het
Snrnp200 T C 2: 127,218,429 I531T probably damaging Het
Ssh3 A T 19: 4,267,964 V41E probably damaging Het
Tars G T 15: 11,393,262 N115K probably benign Het
Tomm6 G C 17: 47,687,925 F34L possibly damaging Het
Txnrd2 G A 16: 18,440,851 V173M possibly damaging Het
Uba6 T A 5: 86,141,595 I450F possibly damaging Het
Vmn2r95 G T 17: 18,443,851 S516I possibly damaging Het
Vps4b A G 1: 106,782,684 F156L possibly damaging Het
Zfp354c T A 11: 50,815,192 H352L probably damaging Het
Zfp521 T C 18: 13,939,093 D30G probably benign Het
Zic2 A T 14: 122,476,118 H148L possibly damaging Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147865865 missense probably damaging 1.00
IGL02134:Miip APN 4 147865278 splice site probably benign
IGL02829:Miip APN 4 147863061 missense probably benign 0.01
IGL03350:Miip APN 4 147862522 missense probably benign 0.01
R0200:Miip UTSW 4 147862263 missense probably damaging 0.99
R1647:Miip UTSW 4 147865234 missense probably benign 0.02
R1783:Miip UTSW 4 147865774 missense probably damaging 1.00
R1848:Miip UTSW 4 147863092 missense probably damaging 0.99
R1944:Miip UTSW 4 147865965 missense probably benign 0.15
R3615:Miip UTSW 4 147865914 missense probably benign 0.00
R3616:Miip UTSW 4 147865914 missense probably benign 0.00
R3882:Miip UTSW 4 147861052 missense possibly damaging 0.93
R4579:Miip UTSW 4 147861061 missense probably damaging 1.00
R5183:Miip UTSW 4 147863069 missense probably damaging 1.00
R6054:Miip UTSW 4 147865678 missense probably benign 0.00
R6056:Miip UTSW 4 147862335 missense probably damaging 1.00
R6304:Miip UTSW 4 147863083 missense probably benign 0.12
R6568:Miip UTSW 4 147865915 missense probably benign
R6603:Miip UTSW 4 147865923 missense possibly damaging 0.92
R7639:Miip UTSW 4 147862564 missense probably benign 0.22
R7701:Miip UTSW 4 147862914 missense probably null 0.86
R7795:Miip UTSW 4 147862918 missense probably benign 0.17
R7796:Miip UTSW 4 147862918 missense probably benign 0.17
R7797:Miip UTSW 4 147862918 missense probably benign 0.17
R7872:Miip UTSW 4 147862918 missense probably benign 0.17
R7920:Miip UTSW 4 147862918 missense probably benign 0.17
R8468:Miip UTSW 4 147861471 missense probably damaging 1.00
R8492:Miip UTSW 4 147861424 missense probably damaging 1.00
R8677:Miip UTSW 4 147863046 missense probably damaging 1.00
R8860:Miip UTSW 4 147866382 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTTGCACCGTCAATGAAATGG -3'
(R):5'- TCTCTTGGCAGGCAAGGAAG -3'

Sequencing Primer
(F):5'- CCGTCAATGAAATGGGTGCATCAC -3'
(R):5'- TGGCAGGCAAGGAAGCAGAG -3'
Posted On2021-07-15