Incidental Mutation 'R8852:Miip'
ID 675048
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission 068674-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R8852 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 147945235-147953176 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) T to A at 147950839 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000094481] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably benign
Transcript: ENSMUST00000030886
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094481
SMART Domains Protein: ENSMUSP00000092054
Gene: ENSMUSG00000070583

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
coiled coil region 86 116 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119975
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172710
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,231,197 (GRCm39) V985G possibly damaging Het
Acr T G 15: 89,458,057 (GRCm39) M246R probably damaging Het
Adgrf5 G T 17: 43,763,989 (GRCm39) V1304L possibly damaging Het
Ago4 A T 4: 126,387,043 (GRCm39) D853E probably benign Het
Arvcf C A 16: 18,222,203 (GRCm39) D790E probably benign Het
Atp8a2 A C 14: 60,162,545 (GRCm39) D725E probably damaging Het
C2cd5 A G 6: 143,028,946 (GRCm39) Y98H probably benign Het
Camkk2 T C 5: 122,891,820 (GRCm39) Y234C probably damaging Het
Ccdc106 A G 7: 5,062,570 (GRCm39) D192G probably benign Het
Ccm2l T C 2: 152,916,788 (GRCm39) Y340H probably damaging Het
Chd1l A G 3: 97,477,685 (GRCm39) F690S probably benign Het
Chuk A G 19: 44,076,407 (GRCm39) S435P possibly damaging Het
Cisd3 T A 11: 97,576,703 (GRCm39) S10T probably benign Het
Cnppd1 A G 1: 75,113,063 (GRCm39) S402P probably damaging Het
Cped1 A G 6: 22,215,620 (GRCm39) D718G probably damaging Het
Crtc1 A G 8: 70,840,805 (GRCm39) S474P probably damaging Het
Dcpp3 G T 17: 24,138,123 (GRCm39) E94* probably null Het
Dhx38 A T 8: 110,289,361 (GRCm39) L13* probably null Het
Dmbt1 T C 7: 130,642,853 (GRCm39) Y120H unknown Het
Fntb T A 12: 76,934,826 (GRCm39) V201E possibly damaging Het
Gga3 T C 11: 115,481,244 (GRCm39) D242G probably benign Het
Gsx2 T C 5: 75,236,996 (GRCm39) M192T possibly damaging Het
Hif3a A T 7: 16,774,912 (GRCm39) M562K probably benign Het
Irf5 G A 6: 29,535,997 (GRCm39) R337H probably damaging Het
Kcnmb3 A G 3: 32,526,624 (GRCm39) V189A possibly damaging Het
Letmd1 A G 15: 100,373,247 (GRCm39) T241A probably benign Het
Lrrc14b T A 13: 74,509,408 (GRCm39) D333V probably damaging Het
Meaf6 T A 4: 124,979,990 (GRCm39) L48Q probably damaging Het
Muc4 A G 16: 32,569,461 (GRCm39) T236A possibly damaging Het
Myh4 T A 11: 67,132,335 (GRCm39) I155N probably damaging Het
Obscn C T 11: 58,898,440 (GRCm39) R6607Q unknown Het
Or2ak7 C T 11: 58,574,966 (GRCm39) T89I probably benign Het
Or5v1 G A 17: 37,810,321 (GRCm39) V260M probably benign Het
Otof T C 5: 30,529,044 (GRCm39) N1788S possibly damaging Het
Psapl1 T C 5: 36,362,314 (GRCm39) L302S probably damaging Het
Rdh8 A C 9: 20,734,021 (GRCm39) N69T probably benign Het
Ryr3 T C 2: 112,624,844 (GRCm39) E2212G probably damaging Het
Septin7 A T 9: 25,163,980 (GRCm39) N16Y possibly damaging Het
Slc22a17 A T 14: 55,146,436 (GRCm39) L60Q probably damaging Het
Snrnp200 T C 2: 127,060,349 (GRCm39) I531T probably damaging Het
Ssh3 A T 19: 4,317,992 (GRCm39) V41E probably damaging Het
Tars1 G T 15: 11,393,348 (GRCm39) N115K probably benign Het
Tomm6 G C 17: 47,998,850 (GRCm39) F34L possibly damaging Het
Txnrd2 G A 16: 18,259,601 (GRCm39) V173M possibly damaging Het
Uba6 T A 5: 86,289,454 (GRCm39) I450F possibly damaging Het
Vmn2r95 G T 17: 18,664,113 (GRCm39) S516I possibly damaging Het
Vps4b A G 1: 106,710,414 (GRCm39) F156L possibly damaging Het
Zfp354c T A 11: 50,706,019 (GRCm39) H352L probably damaging Het
Zfp521 T C 18: 14,072,150 (GRCm39) D30G probably benign Het
Zic2 A T 14: 122,713,530 (GRCm39) H148L possibly damaging Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147,950,322 (GRCm39) missense probably damaging 1.00
IGL02134:Miip APN 4 147,949,735 (GRCm39) splice site probably benign
IGL02829:Miip APN 4 147,947,518 (GRCm39) missense probably benign 0.01
IGL03350:Miip APN 4 147,946,979 (GRCm39) missense probably benign 0.01
R0200:Miip UTSW 4 147,946,720 (GRCm39) missense probably damaging 0.99
R1647:Miip UTSW 4 147,949,691 (GRCm39) missense probably benign 0.02
R1783:Miip UTSW 4 147,950,231 (GRCm39) missense probably damaging 1.00
R1848:Miip UTSW 4 147,947,549 (GRCm39) missense probably damaging 0.99
R1944:Miip UTSW 4 147,950,422 (GRCm39) missense probably benign 0.15
R3615:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3616:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3882:Miip UTSW 4 147,945,509 (GRCm39) missense possibly damaging 0.93
R4579:Miip UTSW 4 147,945,518 (GRCm39) missense probably damaging 1.00
R5183:Miip UTSW 4 147,947,526 (GRCm39) missense probably damaging 1.00
R6054:Miip UTSW 4 147,950,135 (GRCm39) missense probably benign 0.00
R6056:Miip UTSW 4 147,946,792 (GRCm39) missense probably damaging 1.00
R6304:Miip UTSW 4 147,947,540 (GRCm39) missense probably benign 0.12
R6568:Miip UTSW 4 147,950,372 (GRCm39) missense probably benign
R6603:Miip UTSW 4 147,950,380 (GRCm39) missense possibly damaging 0.92
R7639:Miip UTSW 4 147,947,021 (GRCm39) missense probably benign 0.22
R7701:Miip UTSW 4 147,947,371 (GRCm39) missense probably null 0.86
R7795:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7796:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7797:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7872:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7920:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R8468:Miip UTSW 4 147,945,928 (GRCm39) missense probably damaging 1.00
R8492:Miip UTSW 4 147,945,881 (GRCm39) missense probably damaging 1.00
R8677:Miip UTSW 4 147,947,503 (GRCm39) missense probably damaging 1.00
R8860:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R9755:Miip UTSW 4 147,950,319 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTGCACCGTCAATGAAATGG -3'
(R):5'- TCTCTTGGCAGGCAAGGAAG -3'

Sequencing Primer
(F):5'- CCGTCAATGAAATGGGTGCATCAC -3'
(R):5'- TGGCAGGCAAGGAAGCAGAG -3'
Posted On 2021-07-15