Mutagenetix > Incidental Mutation

Incidental Mutation 'R0730:Tg'

67507

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000053469

Gene Name

thyroglobulin

Synonyms

Tgn

MMRRC Submission

038911-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R0730 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66670753-66850721 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66678789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 256 (D256V)

Ref Sequence

ENSEMBL: ENSMUSP00000070239 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065916]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065916
AA Change: D256V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: D256V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TY	50	97	5.9e-16	SMART
TY	118	165	5.59e-17	SMART
Pfam:Thyroglobulin_1	174	252	4e-9	PFAM
TY	317	363	4.36e-19	SMART
low complexity region	495	504	N/A	INTRINSIC
TY	617	662	3.58e-15	SMART
TY	684	730	1.47e-16	SMART
TY	880	926	1.51e-4	SMART
TY	1029	1078	1.21e-12	SMART
TY	1106	1150	7.56e-5	SMART
TY	1167	1215	7.26e-16	SMART
low complexity region	1244	1255	N/A	INTRINSIC
Pfam:GCC2_GCC3	1464	1509	2.7e-16	PFAM
TY	1519	1568	9.81e-13	SMART
Pfam:COesterase	2181	2717	8.4e-140	PFAM

Meta Mutation Damage Score

0.1926

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.8%
20x: 96.1%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,469,535	H509L	probably benign	Het
9930021J03Rik	T	A	19: 29,717,981	I1438F	probably benign	Het
Adam9	A	T	8: 24,996,758	I168N	probably benign	Het
Adamts20	G	A	15: 94,347,690	A577V	probably benign	Het
Agtr1a	A	T	13: 30,381,296	S115C	probably damaging	Het
Ankrd11	T	C	8: 122,891,953	Y1720C	probably damaging	Het
Ano6	A	T	15: 95,920,371	T353S	probably damaging	Het
App	A	G	16: 85,079,952	F184L	probably damaging	Het
Arhgef38	T	A	3: 133,137,471	Y446F	probably benign	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Atp1a4	G	A	1: 172,240,207		probably benign	Het
Bdp1	G	A	13: 100,058,951		probably benign	Het
Bicd2	T	A	13: 49,378,241	S246T	possibly damaging	Het
Bsn	T	A	9: 108,106,812	M3348L	unknown	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cacna2d3	T	C	14: 28,982,365	I820V	probably benign	Het
Cdc40	A	G	10: 40,844,956		probably benign	Het
Cdh23	T	C	10: 60,323,714	E2094G	probably damaging	Het
Celsr2	T	A	3: 108,398,606	N2061Y	probably damaging	Het
Cfap206	G	A	4: 34,711,391	A502V	probably benign	Het
Cfap54	T	C	10: 93,034,737	T29A	probably benign	Het
Cfap57	T	C	4: 118,612,920		probably null	Het
Chd5	A	G	4: 152,347,984	E43G	possibly damaging	Het
Clk1	G	A	1: 58,414,399	H343Y	probably benign	Het
Cntn4	A	C	6: 106,550,486	K443T	probably damaging	Het
Csn2	G	A	5: 87,694,952	A72V	possibly damaging	Het
Ctdp1	T	A	18: 80,450,242	H346L	probably benign	Het
Ctif	A	T	18: 75,565,012	N192K	probably damaging	Het
Ddr2	G	A	1: 169,995,566	A383V	probably benign	Het
Derl3	C	T	10: 75,895,242		probably benign	Het
Dgkh	T	C	14: 78,584,479	I865V	probably damaging	Het
Dip2b	C	T	15: 100,171,651	A619V	probably damaging	Het
Eml1	A	G	12: 108,530,326	T614A	possibly damaging	Het
Eogt	G	C	6: 97,116,009	Y402*	probably null	Het
Erbb4	A	G	1: 68,259,290	V647A	probably damaging	Het
Esm1	G	T	13: 113,213,502		probably null	Het
Fbxo31	A	G	8: 121,555,364		probably benign	Het
Fbxw5	T	A	2: 25,504,618	D201E	possibly damaging	Het
Fgfr1	G	A	8: 25,555,744	D123N	probably benign	Het
G530012D18Rik	A	C	1: 85,577,036		probably benign	Het
Gnat1	G	A	9: 107,679,463	T29I	probably damaging	Het
Gtf2ird2	A	T	5: 134,192,758	R67*	probably null	Het
Iltifb	A	T	10: 118,294,237	D87E	probably benign	Het
Kcnq3	T	C	15: 65,995,608	T729A	probably benign	Het
Klrc2	A	T	6: 129,658,696	S156R	probably damaging	Het
Krt76	A	T	15: 101,887,349	L462Q	probably damaging	Het
Lama3	C	A	18: 12,456,850		probably benign	Het
Lin28a	A	T	4: 134,008,008	S56T	probably damaging	Het
Macf1	A	G	4: 123,382,530		probably benign	Het
Macrod2	C	T	2: 142,217,674		probably benign	Het
Mansc1	C	T	6: 134,617,461		probably benign	Het
Map1b	G	T	13: 99,429,766	S2149*	probably null	Het
Mgst1	A	T	6: 138,147,669	T34S	probably benign	Het
Mlf2	C	T	6: 124,934,391	T123M	probably damaging	Het
Mospd2	C	T	X: 164,948,257		probably benign	Het
Mrpl15	A	T	1: 4,777,611	V155E	probably damaging	Het
Mstn	A	T	1: 53,061,794	Y10F	possibly damaging	Het
Myo1g	C	T	11: 6,520,794	V21M	probably damaging	Het
Myom2	T	C	8: 15,099,326	I599T	probably benign	Het
Ndc80	A	T	17: 71,496,246	N633K	probably benign	Het
Nhs	C	A	X: 161,837,300	V1487L	possibly damaging	Het
Npc1	T	C	18: 12,219,325	T106A	probably benign	Het
Nup133	C	T	8: 123,949,008	V57M	probably benign	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Olfr1045	A	G	2: 86,198,725	V9A	probably benign	Het
Olfr1106	T	C	2: 87,049,148	I29M	probably benign	Het
Olfr818	T	A	10: 129,945,111	H317L	probably benign	Het
Oprm1	T	C	10: 6,832,652		probably benign	Het
Ostf1	C	T	19: 18,604,207	V14I	unknown	Het
Pcdhb14	C	A	18: 37,448,868	D342E	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Pdpr	T	C	8: 111,125,755		probably null	Het
Plce1	G	A	19: 38,716,691	V847M	probably damaging	Het
Pon3	A	G	6: 5,230,444	M288T	probably benign	Het
Psd2	A	T	18: 35,978,574	D84V	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ralgapa1	T	C	12: 55,665,663	K1808E	probably damaging	Het
Ramp3	T	C	11: 6,676,476		probably benign	Het
Rasgrf1	T	A	9: 89,951,009		probably benign	Het
Rictor	A	G	15: 6,773,986		probably benign	Het
Rptor	A	T	11: 119,884,954	I984F	probably benign	Het
Slc1a6	C	T	10: 78,796,008	P223S	probably benign	Het
Taar8b	A	C	10: 24,092,026	V90G	probably damaging	Het
Tbc1d21	A	G	9: 58,359,877	V327A	probably benign	Het
Tex21	T	C	12: 76,204,166	T499A	probably benign	Het
Tmf1	A	G	6: 97,176,492	S207P	probably benign	Het
Tpr	A	G	1: 150,393,407		probably benign	Het
Ufd1	A	G	16: 18,814,887	T21A	probably damaging	Het
Unc13a	T	C	8: 71,656,285	D115G	possibly damaging	Het
Usb1	T	A	8: 95,344,041	F198L	probably damaging	Het
Utrn	A	T	10: 12,698,158		probably benign	Het
Vars	A	G	17: 35,014,300	N954S	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Wdr33	C	T	18: 31,835,376		probably benign	Het
Zfp236	A	G	18: 82,640,244		probably benign	Het
Zfp445	A	T	9: 122,861,758	V124E	probably damaging	Het
Zfp616	A	T	11: 74,084,822	H639L	probably damaging	Het
Zfyve16	C	A	13: 92,521,477	S642I	probably damaging	Het
Zswim5	C	T	4: 116,985,746	T896I	possibly damaging	Het

Other mutations in Tg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Tg	APN	15	66847166	missense	probably damaging	1.00
IGL00230:Tg	APN	15	66827290	missense	probably benign	0.00
IGL00324:Tg	APN	15	66693424	missense	probably benign
IGL00428:Tg	APN	15	66773424	missense	probably benign	0.33
IGL00703:Tg	APN	15	66696489	missense	probably benign	0.34
IGL00808:Tg	APN	15	66683813	missense	probably damaging	1.00
IGL00833:Tg	APN	15	66688801	missense	probably benign	0.34
IGL00899:Tg	APN	15	66674073	critical splice donor site	probably null
IGL00921:Tg	APN	15	66764453	missense	probably benign	0.28
IGL00975:Tg	APN	15	66681882	missense	probably benign
IGL01288:Tg	APN	15	66736276	missense	possibly damaging	0.81
IGL01397:Tg	APN	15	66696092	splice site	probably benign
IGL01634:Tg	APN	15	66729566	missense	probably benign	0.34
IGL01646:Tg	APN	15	66678087	missense	probably damaging	1.00
IGL01704:Tg	APN	15	66671351	missense	probably damaging	0.98
IGL01958:Tg	APN	15	66759486	missense	probably benign	0.06
IGL02093:Tg	APN	15	66692374	missense	possibly damaging	0.83
IGL02113:Tg	APN	15	66705330	missense	probably benign	0.08
IGL02138:Tg	APN	15	66717233	missense	probably benign	0.01
IGL02156:Tg	APN	15	66705348	missense	probably benign	0.19
IGL02169:Tg	APN	15	66757943	missense	probably benign	0.04
IGL02342:Tg	APN	15	66764291	missense	probably benign
IGL02434:Tg	APN	15	66764342	missense	probably damaging	0.97
IGL02506:Tg	APN	15	66741594	missense	possibly damaging	0.71
IGL02513:Tg	APN	15	66705274	missense	probably benign
IGL02549:Tg	APN	15	66839361	missense	probably damaging	1.00
IGL02669:Tg	APN	15	66748726	splice site	probably benign
IGL02756:Tg	APN	15	66734586	missense	probably benign
IGL02800:Tg	APN	15	66757886	missense	probably damaging	1.00
IGL02828:Tg	APN	15	66682394	missense	probably damaging	1.00
IGL02927:Tg	APN	15	66678093	missense	probably damaging	1.00
IGL03061:Tg	APN	15	66671405	missense	probably damaging	1.00
IGL03105:Tg	APN	15	66715106	missense	probably benign	0.01
IGL03160:Tg	APN	15	66839303	nonsense	probably null
IGL03242:Tg	APN	15	66683798	missense	probably damaging	0.99
Also_ran	UTSW	15	66678839	missense	probably damaging	1.00
bedraggled	UTSW	15	66740714	missense	probably damaging	1.00
foster	UTSW	15	66693260	nonsense	probably null
hognose	UTSW	15	66717208	missense	probably damaging	0.99
ito	UTSW	15	66766162	nonsense	probably null
ito2	UTSW	15	66671396	missense	probably damaging	1.00
ito3	UTSW	15	66773474	missense	probably damaging	1.00
ito4	UTSW	15	66696520	missense	possibly damaging	0.47
Papua	UTSW	15	66674050	missense	probably damaging	1.00
Pipistrella	UTSW	15	66696135	missense	probably damaging	1.00
pluribus	UTSW	15	66715163	missense	probably damaging	0.98
samarai	UTSW	15	66758006	critical splice donor site	probably null
sariba	UTSW	15	66694870	missense	probably benign	0.01
ticker	UTSW	15	66827382	nonsense	probably null
Vampire	UTSW	15	66682827	missense	probably damaging	1.00
IGL03134:Tg	UTSW	15	66740718	missense	probably damaging	1.00
P0019:Tg	UTSW	15	66688863	missense	probably benign	0.01
R0121:Tg	UTSW	15	66740781	missense	probably benign	0.04
R0135:Tg	UTSW	15	66694870	missense	probably benign	0.01
R0227:Tg	UTSW	15	66698446	missense	possibly damaging	0.84
R0448:Tg	UTSW	15	66764442	missense	probably damaging	1.00
R0453:Tg	UTSW	15	66828533	missense	probably benign	0.09
R0504:Tg	UTSW	15	66682404	missense	probably damaging	0.97
R0543:Tg	UTSW	15	66729597	missense	probably benign	0.13
R0638:Tg	UTSW	15	66717208	missense	probably damaging	0.99
R0639:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0646:Tg	UTSW	15	66729626	missense	probably damaging	0.99
R0666:Tg	UTSW	15	66737521	missense	probably benign
R0673:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0689:Tg	UTSW	15	66839404	splice site	probably benign
R0704:Tg	UTSW	15	66757880	missense	probably benign	0.02
R0830:Tg	UTSW	15	66725144	missense	probably damaging	1.00
R0959:Tg	UTSW	15	66708010	missense	probably damaging	0.98
R1027:Tg	UTSW	15	66672409	missense	possibly damaging	0.65
R1061:Tg	UTSW	15	66698559	missense	probably benign	0.09
R1086:Tg	UTSW	15	66684062	missense	probably benign
R1103:Tg	UTSW	15	66719655	missense	probably benign	0.45
R1240:Tg	UTSW	15	66828548	missense	probably benign	0.16
R1281:Tg	UTSW	15	66696489	missense	probably benign	0.34
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1531:Tg	UTSW	15	66850502	missense	probably benign	0.02
R1544:Tg	UTSW	15	66705232	missense	probably benign	0.04
R1550:Tg	UTSW	15	66693430	missense	possibly damaging	0.52
R1575:Tg	UTSW	15	66729685	critical splice donor site	probably null
R1638:Tg	UTSW	15	66696166	nonsense	probably null
R1655:Tg	UTSW	15	66828568	critical splice donor site	probably null
R1671:Tg	UTSW	15	66692387	missense	possibly damaging	0.89
R1789:Tg	UTSW	15	66737548	missense	probably benign	0.00
R1883:Tg	UTSW	15	66671309	missense	probably damaging	1.00
R1984:Tg	UTSW	15	66682842	missense	probably benign
R2063:Tg	UTSW	15	66828553	missense	probably damaging	1.00
R2092:Tg	UTSW	15	66849607	missense	probably null	0.26
R2109:Tg	UTSW	15	66729594	missense	probably benign	0.02
R2128:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2129:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2207:Tg	UTSW	15	66681939	missense	probably benign	0.15
R2219:Tg	UTSW	15	66681933	missense	probably benign	0.03
R2228:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2229:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2259:Tg	UTSW	15	66683898	missense	probably benign
R2994:Tg	UTSW	15	66681953	missense	probably benign
R3904:Tg	UTSW	15	66766162	nonsense	probably null
R3946:Tg	UTSW	15	66674023	missense	probably damaging	1.00
R3965:Tg	UTSW	15	66684190	missense	probably benign
R4245:Tg	UTSW	15	66696469	missense	possibly damaging	0.68
R4451:Tg	UTSW	15	66766147	missense	probably benign	0.01
R4487:Tg	UTSW	15	66671396	missense	probably damaging	1.00
R4489:Tg	UTSW	15	66707942	missense	probably damaging	1.00
R4623:Tg	UTSW	15	66735271	missense	probably benign	0.23
R4659:Tg	UTSW	15	66673920	missense	possibly damaging	0.67
R4728:Tg	UTSW	15	66682827	missense	probably damaging	1.00
R4760:Tg	UTSW	15	66693319	missense	probably damaging	1.00
R4797:Tg	UTSW	15	66758006	critical splice donor site	probably null
R4944:Tg	UTSW	15	66764337	missense	probably damaging	1.00
R4998:Tg	UTSW	15	66674050	missense	probably damaging	1.00
R5009:Tg	UTSW	15	66696586	missense	probably benign	0.01
R5025:Tg	UTSW	15	66707930	missense	probably damaging	1.00
R5035:Tg	UTSW	15	66681813	splice site	probably null
R5049:Tg	UTSW	15	66827382	nonsense	probably null
R5073:Tg	UTSW	15	66735252	missense	probably benign	0.05
R5169:Tg	UTSW	15	66678780	nonsense	probably null
R5185:Tg	UTSW	15	66773474	missense	probably damaging	1.00
R5227:Tg	UTSW	15	66759567	missense	possibly damaging	0.87
R5300:Tg	UTSW	15	66678855	missense	probably damaging	1.00
R5334:Tg	UTSW	15	66678055	missense	probably damaging	1.00
R5339:Tg	UTSW	15	66678093	missense	probably damaging	1.00
R5402:Tg	UTSW	15	66739168	missense	probably damaging	0.98
R5441:Tg	UTSW	15	66696520	missense	possibly damaging	0.47
R5509:Tg	UTSW	15	66827293	missense	probably benign	0.45
R5580:Tg	UTSW	15	66685300	missense	possibly damaging	0.66
R5582:Tg	UTSW	15	66693435	missense	probably damaging	1.00
R5624:Tg	UTSW	15	66838057	missense	probably benign	0.11
R5686:Tg	UTSW	15	66688889	missense	probably benign	0.28
R6042:Tg	UTSW	15	66683993	missense	probably benign	0.01
R6122:Tg	UTSW	15	66828457	missense	probably damaging	1.00
R6146:Tg	UTSW	15	66673367	splice site	probably null
R6159:Tg	UTSW	15	66735247	missense	possibly damaging	0.71
R6223:Tg	UTSW	15	66707922	missense	probably benign	0.15
R6480:Tg	UTSW	15	66671311	missense	probably damaging	1.00
R6505:Tg	UTSW	15	66759558	missense	probably damaging	0.99
R6531:Tg	UTSW	15	66839362	missense	probably damaging	0.99
R6614:Tg	UTSW	15	66735259	missense	probably damaging	0.99
R6698:Tg	UTSW	15	66839362	missense	probably damaging	1.00
R6798:Tg	UTSW	15	66678839	missense	probably damaging	1.00
R6837:Tg	UTSW	15	66696135	missense	probably damaging	1.00
R6861:Tg	UTSW	15	66688891	missense	probably benign	0.00
R6888:Tg	UTSW	15	66696246	missense	probably damaging	0.99
R6933:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R6983:Tg	UTSW	15	66693358	missense	probably benign	0.01
R7078:Tg	UTSW	15	66673543	missense	probably damaging	1.00
R7244:Tg	UTSW	15	66740714	missense	probably damaging	1.00
R7320:Tg	UTSW	15	66694784	missense	possibly damaging	0.71
R7334:Tg	UTSW	15	66725272	missense	probably benign	0.01
R7418:Tg	UTSW	15	66696583	missense	probably damaging	0.99
R7485:Tg	UTSW	15	66696588	missense	probably benign	0.04
R7524:Tg	UTSW	15	66696161	missense	probably benign	0.01
R7529:Tg	UTSW	15	66694768	missense	probably damaging	0.99
R7540:Tg	UTSW	15	66689927	missense	probably benign	0.16
R7583:Tg	UTSW	15	66764418	missense	probably damaging	1.00
R7594:Tg	UTSW	15	66729583	missense	probably benign	0.20
R7667:Tg	UTSW	15	66715163	missense	probably damaging	0.98
R7722:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R7790:Tg	UTSW	15	66849604	missense	probably damaging	0.99
R7838:Tg	UTSW	15	66693263	missense	probably benign	0.00
R7890:Tg	UTSW	15	66683814	missense	probably damaging	1.00
R7904:Tg	UTSW	15	66705279	missense	probably benign	0.08
R7919:Tg	UTSW	15	66684074	missense	possibly damaging	0.73
R7921:Tg	UTSW	15	66683793	missense	probably benign	0.08
R8037:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8038:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8214:Tg	UTSW	15	66773398	missense	probably damaging	1.00
R8304:Tg	UTSW	15	66693260	nonsense	probably null
R8688:Tg	UTSW	15	66694953	critical splice donor site	probably benign
R8709:Tg	UTSW	15	66681937	missense	probably benign	0.08
R8714:Tg	UTSW	15	66684042	missense	probably damaging	0.97
R8901:Tg	UTSW	15	66685335	missense	probably damaging	1.00
R8917:Tg	UTSW	15	66773483	critical splice donor site	probably null
R9023:Tg	UTSW	15	66683673	missense	probably damaging	1.00
R9232:Tg	UTSW	15	66698461	missense	probably benign	0.01
R9310:Tg	UTSW	15	66827269	missense	possibly damaging	0.69
R9361:Tg	UTSW	15	66685397	missense	possibly damaging	0.50
R9389:Tg	UTSW	15	66689324	missense	probably benign	0.04
R9501:Tg	UTSW	15	66847074	missense	possibly damaging	0.52
R9510:Tg	UTSW	15	66674064	missense	probably damaging	1.00
R9594:Tg	UTSW	15	66735260	nonsense	probably null
R9629:Tg	UTSW	15	66683738	missense	possibly damaging	0.95
R9701:Tg	UTSW	15	66766142	missense	probably benign	0.03
R9743:Tg	UTSW	15	66689990	missense	probably benign	0.18
R9748:Tg	UTSW	15	66847159	missense	possibly damaging	0.91
T0975:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0005:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0065:Tg	UTSW	15	66682454	missense	probably damaging	1.00
X0067:Tg	UTSW	15	66748743	missense	probably benign	0.10
Z1177:Tg	UTSW	15	66685310	missense	possibly damaging	0.49
Z1177:Tg	UTSW	15	66849547	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGCTTTCATCTGTGCTGTCAGACC -3'
(R):5'- TATGCTGCCTCAGAGCTAACTCCC -3'

Sequencing Primer
(F):5'- gcttagcaaaagatatgaccctac -3'
(R):5'- CTTTGATGTAACAGCCATGCAG -3'

Posted On

2013-09-03