Mutagenetix > Incidental Mutation

Incidental Mutation 'R8852:Zic2'

675076

Institutional Source

Beutler Lab

Gene Symbol

Zic2

Ensembl Gene

ENSMUSG00000061524

Gene Name

zinc finger protein of the cerebellum 2

Synonyms

odd-paired homolog, GENA 29, Ku

MMRRC Submission

068674-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R8852 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122712847-122717264 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122713530 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 148 (H148L)

Ref Sequence

ENSEMBL: ENSMUSP00000075283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075888]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075888
AA Change: H148L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524
AA Change: H148L

Domain	Start	End	E-Value	Type
low complexity region	18	33	N/A	INTRINSIC
low complexity region	81	103	N/A	INTRINSIC
low complexity region	131	150	N/A	INTRINSIC
low complexity region	215	241	N/A	INTRINSIC
ZnF_C2H2	265	290	5.68e1	SMART
ZnF_C2H2	299	326	6.92e0	SMART
ZnF_C2H2	332	356	8.02e-5	SMART
ZnF_C2H2	362	386	1.69e-3	SMART
ZnF_C2H2	392	414	4.54e-4	SMART
low complexity region	416	434	N/A	INTRINSIC
low complexity region	455	519	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	G	12: 71,231,197 (GRCm39)	V985G	possibly damaging	Het
Acr	T	G	15: 89,458,057 (GRCm39)	M246R	probably damaging	Het
Adgrf5	G	T	17: 43,763,989 (GRCm39)	V1304L	possibly damaging	Het
Ago4	A	T	4: 126,387,043 (GRCm39)	D853E	probably benign	Het
Arvcf	C	A	16: 18,222,203 (GRCm39)	D790E	probably benign	Het
Atp8a2	A	C	14: 60,162,545 (GRCm39)	D725E	probably damaging	Het
C2cd5	A	G	6: 143,028,946 (GRCm39)	Y98H	probably benign	Het
Camkk2	T	C	5: 122,891,820 (GRCm39)	Y234C	probably damaging	Het
Ccdc106	A	G	7: 5,062,570 (GRCm39)	D192G	probably benign	Het
Ccm2l	T	C	2: 152,916,788 (GRCm39)	Y340H	probably damaging	Het
Chd1l	A	G	3: 97,477,685 (GRCm39)	F690S	probably benign	Het
Chuk	A	G	19: 44,076,407 (GRCm39)	S435P	possibly damaging	Het
Cisd3	T	A	11: 97,576,703 (GRCm39)	S10T	probably benign	Het
Cnppd1	A	G	1: 75,113,063 (GRCm39)	S402P	probably damaging	Het
Cped1	A	G	6: 22,215,620 (GRCm39)	D718G	probably damaging	Het
Crtc1	A	G	8: 70,840,805 (GRCm39)	S474P	probably damaging	Het
Dcpp3	G	T	17: 24,138,123 (GRCm39)	E94*	probably null	Het
Dhx38	A	T	8: 110,289,361 (GRCm39)	L13*	probably null	Het
Dmbt1	T	C	7: 130,642,853 (GRCm39)	Y120H	unknown	Het
Fntb	T	A	12: 76,934,826 (GRCm39)	V201E	possibly damaging	Het
Gga3	T	C	11: 115,481,244 (GRCm39)	D242G	probably benign	Het
Gsx2	T	C	5: 75,236,996 (GRCm39)	M192T	possibly damaging	Het
Hif3a	A	T	7: 16,774,912 (GRCm39)	M562K	probably benign	Het
Irf5	G	A	6: 29,535,997 (GRCm39)	R337H	probably damaging	Het
Kcnmb3	A	G	3: 32,526,624 (GRCm39)	V189A	possibly damaging	Het
Letmd1	A	G	15: 100,373,247 (GRCm39)	T241A	probably benign	Het
Lrrc14b	T	A	13: 74,509,408 (GRCm39)	D333V	probably damaging	Het
Meaf6	T	A	4: 124,979,990 (GRCm39)	L48Q	probably damaging	Het
Miip	T	A	4: 147,950,839 (GRCm39)		probably benign	Het
Muc4	A	G	16: 32,569,461 (GRCm39)	T236A	possibly damaging	Het
Myh4	T	A	11: 67,132,335 (GRCm39)	I155N	probably damaging	Het
Obscn	C	T	11: 58,898,440 (GRCm39)	R6607Q	unknown	Het
Or2ak7	C	T	11: 58,574,966 (GRCm39)	T89I	probably benign	Het
Or5v1	G	A	17: 37,810,321 (GRCm39)	V260M	probably benign	Het
Otof	T	C	5: 30,529,044 (GRCm39)	N1788S	possibly damaging	Het
Psapl1	T	C	5: 36,362,314 (GRCm39)	L302S	probably damaging	Het
Rdh8	A	C	9: 20,734,021 (GRCm39)	N69T	probably benign	Het
Ryr3	T	C	2: 112,624,844 (GRCm39)	E2212G	probably damaging	Het
Septin7	A	T	9: 25,163,980 (GRCm39)	N16Y	possibly damaging	Het
Slc22a17	A	T	14: 55,146,436 (GRCm39)	L60Q	probably damaging	Het
Snrnp200	T	C	2: 127,060,349 (GRCm39)	I531T	probably damaging	Het
Ssh3	A	T	19: 4,317,992 (GRCm39)	V41E	probably damaging	Het
Tars1	G	T	15: 11,393,348 (GRCm39)	N115K	probably benign	Het
Tomm6	G	C	17: 47,998,850 (GRCm39)	F34L	possibly damaging	Het
Txnrd2	G	A	16: 18,259,601 (GRCm39)	V173M	possibly damaging	Het
Uba6	T	A	5: 86,289,454 (GRCm39)	I450F	possibly damaging	Het
Vmn2r95	G	T	17: 18,664,113 (GRCm39)	S516I	possibly damaging	Het
Vps4b	A	G	1: 106,710,414 (GRCm39)	F156L	possibly damaging	Het
Zfp354c	T	A	11: 50,706,019 (GRCm39)	H352L	probably damaging	Het
Zfp521	T	C	18: 14,072,150 (GRCm39)	D30G	probably benign	Het

Other mutations in Zic2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Zic2	APN	14	122,715,971 (GRCm39)	nonsense	probably null
IGL01607:Zic2	APN	14	122,716,294 (GRCm39)	splice site	probably benign
IGL02307:Zic2	APN	14	122,714,046 (GRCm39)	missense	possibly damaging	0.76
IGL02311:Zic2	APN	14	122,713,606 (GRCm39)	missense	probably damaging	0.99
IGL02561:Zic2	APN	14	122,715,957 (GRCm39)	nonsense	probably null
IGL02982:Zic2	APN	14	122,715,979 (GRCm39)	missense	probably damaging	0.98
R0001:Zic2	UTSW	14	122,716,369 (GRCm39)	missense	probably damaging	0.99
R0027:Zic2	UTSW	14	122,713,755 (GRCm39)	missense	possibly damaging	0.77
R0136:Zic2	UTSW	14	122,713,953 (GRCm39)	missense	probably damaging	0.96
R0310:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0418:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0420:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0421:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0518:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0520:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0521:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0628:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R1733:Zic2	UTSW	14	122,716,359 (GRCm39)	missense	probably damaging	0.97
R1757:Zic2	UTSW	14	122,716,031 (GRCm39)	missense	possibly damaging	0.86
R2398:Zic2	UTSW	14	122,716,329 (GRCm39)	nonsense	probably null
R5323:Zic2	UTSW	14	122,713,728 (GRCm39)	missense	probably damaging	1.00
R5381:Zic2	UTSW	14	122,713,227 (GRCm39)	missense	probably damaging	0.97
R6930:Zic2	UTSW	14	122,713,869 (GRCm39)	missense	probably damaging	0.99
R7223:Zic2	UTSW	14	122,713,503 (GRCm39)	missense	probably damaging	0.98
R8750:Zic2	UTSW	14	122,714,129 (GRCm39)	missense	probably benign	0.06
R8860:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
Z1088:Zic2	UTSW	14	122,716,087 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGTCTCCTGGTCAGAGTTCG -3'
(R):5'- TCATATTCATAGGGCCGTACTGG -3'

Sequencing Primer
(F):5'- TCAGAGTTCGGCGTTCAC -3'
(R):5'- CATAGGGCCGTACTGGTTGTG -3'

Posted On

2021-07-15