Incidental Mutation 'R8853:Myrip'
ID 675128
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission 068675-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8853 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 120132996-120305167 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 120290487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 702 (A702V)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
AlphaFold Q8K3I4
Predicted Effect probably damaging
Transcript: ENSMUST00000048121
AA Change: A702V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: A702V

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,882,994 (GRCm39) Y290F probably benign Het
Ap5m1 T A 14: 49,311,337 (GRCm39) L136M possibly damaging Het
Arpp21 T G 9: 111,976,516 (GRCm39) T322P probably damaging Het
Atp6v1c2 C T 12: 17,351,148 (GRCm39) V128M possibly damaging Het
C4b A G 17: 34,948,879 (GRCm39) V1523A possibly damaging Het
Copg2 G C 6: 30,803,115 (GRCm39) L277V probably benign Het
Cyp2b19 A G 7: 26,456,645 (GRCm39) T12A possibly damaging Het
D5Ertd579e A T 5: 36,787,024 (GRCm39) C115S probably damaging Het
Defb35 G A 8: 22,430,806 (GRCm39) R60Q unknown Het
Dlgap3 T A 4: 127,088,810 (GRCm39) D135E probably damaging Het
Dync2h1 A T 9: 7,117,645 (GRCm39) W2215R possibly damaging Het
Eea1 G C 10: 95,857,517 (GRCm39) A660P Het
Egfr A G 11: 16,858,885 (GRCm39) I955V possibly damaging Het
Eif3b G A 5: 140,425,774 (GRCm39) V655M probably damaging Het
Elp3 T A 14: 65,815,390 (GRCm39) I220F probably benign Het
Ern2 A G 7: 121,772,967 (GRCm39) V550A probably damaging Het
Evc G A 5: 37,460,647 (GRCm39) S857L possibly damaging Het
Glt28d2 T A 3: 85,779,087 (GRCm39) M129L probably benign Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 118,112,269 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,547,726 (GRCm39) Y2742N probably damaging Het
Klhl6 T A 16: 19,765,979 (GRCm39) Q541L possibly damaging Het
Myh14 G A 7: 44,265,678 (GRCm39) T1559I probably benign Het
Myo7b A G 18: 32,119,744 (GRCm39) F783L possibly damaging Het
Ndnf C A 6: 65,680,161 (GRCm39) Q147K probably benign Het
Necab2 C G 8: 120,189,339 (GRCm39) R170G possibly damaging Het
Nfatc4 T C 14: 56,063,690 (GRCm39) I59T probably damaging Het
Nfix A G 8: 85,454,276 (GRCm39) S211P probably damaging Het
Nlrp5 A T 7: 23,117,725 (GRCm39) Q483L possibly damaging Het
Or6k14 T C 1: 173,927,861 (GRCm39) V279A probably damaging Het
Pde4a A G 9: 21,106,119 (GRCm39) T245A possibly damaging Het
Peli2 C T 14: 48,493,945 (GRCm39) T389M probably damaging Het
Pfas T C 11: 68,883,744 (GRCm39) K638E probably damaging Het
Pkhd1 A G 1: 20,143,679 (GRCm39) probably null Het
Plch1 T C 3: 63,688,967 (GRCm39) D67G probably damaging Het
Plcl2 A T 17: 50,913,884 (GRCm39) R298* probably null Het
Ppp1r13l A G 7: 19,103,893 (GRCm39) I125V probably benign Het
Ppp2r3d A G 9: 101,090,110 (GRCm39) V71A probably benign Het
Pvr A G 7: 19,650,897 (GRCm39) V209A possibly damaging Het
Rap1gap2 A G 11: 74,298,198 (GRCm39) L414P probably damaging Het
Rasgrp2 A G 19: 6,464,855 (GRCm39) D601G probably damaging Het
Reck T A 4: 43,912,089 (GRCm39) N199K probably benign Het
Rin2 G T 2: 145,718,475 (GRCm39) A652S possibly damaging Het
Rnf34 T C 5: 123,002,087 (GRCm39) L88P possibly damaging Het
Serpina3m A G 12: 104,355,914 (GRCm39) I194V probably benign Het
Spred3 A G 7: 28,861,415 (GRCm39) S255P probably benign Het
Sult2a7 A G 7: 14,225,641 (GRCm39) probably null Het
Synpo2l C A 14: 20,711,442 (GRCm39) G622C probably damaging Het
Tenm3 A G 8: 48,795,382 (GRCm39) C582R probably damaging Het
Tex261 A T 6: 83,750,727 (GRCm39) I90N probably damaging Het
Trappc11 A G 8: 47,982,439 (GRCm39) F100S probably damaging Het
Trhde G A 10: 114,636,830 (GRCm39) P126S probably benign Het
Vmn2r53 A T 7: 12,315,737 (GRCm39) V694E probably damaging Het
Vmn2r54 A T 7: 12,349,782 (GRCm39) L600Q probably damaging Het
Vwf G A 6: 125,634,227 (GRCm39) C2174Y Het
Wee2 A G 6: 40,441,200 (GRCm39) T502A probably benign Het
Zfp112 A T 7: 23,823,390 (GRCm39) silent Het
Zfp40 T A 17: 23,394,691 (GRCm39) H632L possibly damaging Het
Zmynd11 T C 13: 9,740,965 (GRCm39) S378G probably damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120,217,330 (GRCm39) missense probably damaging 1.00
IGL02108:Myrip APN 9 120,296,631 (GRCm39) critical splice donor site probably null
IGL02406:Myrip APN 9 120,296,598 (GRCm39) missense probably benign
IGL02876:Myrip APN 9 120,261,740 (GRCm39) missense probably damaging 1.00
IGL03109:Myrip APN 9 120,282,790 (GRCm39) splice site probably null
IGL03258:Myrip APN 9 120,270,418 (GRCm39) missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120,296,583 (GRCm39) missense probably damaging 0.98
R0485:Myrip UTSW 9 120,270,443 (GRCm39) missense probably benign 0.01
R0633:Myrip UTSW 9 120,217,302 (GRCm39) missense probably damaging 1.00
R1489:Myrip UTSW 9 120,261,595 (GRCm39) missense probably damaging 1.00
R1539:Myrip UTSW 9 120,253,689 (GRCm39) missense probably benign 0.00
R1708:Myrip UTSW 9 120,293,840 (GRCm39) missense possibly damaging 0.65
R1817:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1818:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1878:Myrip UTSW 9 120,253,721 (GRCm39) missense probably damaging 0.99
R2484:Myrip UTSW 9 120,253,685 (GRCm39) missense probably benign 0.00
R3237:Myrip UTSW 9 120,270,473 (GRCm39) missense possibly damaging 0.91
R3890:Myrip UTSW 9 120,251,324 (GRCm39) missense probably damaging 1.00
R3912:Myrip UTSW 9 120,261,682 (GRCm39) missense probably benign
R3919:Myrip UTSW 9 120,261,695 (GRCm39) missense probably damaging 1.00
R4125:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4126:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4128:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4435:Myrip UTSW 9 120,164,680 (GRCm39) start gained probably benign
R4599:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
R5014:Myrip UTSW 9 120,251,534 (GRCm39) missense probably damaging 1.00
R5665:Myrip UTSW 9 120,290,499 (GRCm39) missense probably damaging 1.00
R5814:Myrip UTSW 9 120,253,734 (GRCm39) missense probably benign 0.06
R5849:Myrip UTSW 9 120,282,759 (GRCm39) missense probably damaging 0.99
R5986:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R6706:Myrip UTSW 9 120,217,359 (GRCm39) missense possibly damaging 0.93
R7019:Myrip UTSW 9 120,251,573 (GRCm39) missense probably damaging 1.00
R7291:Myrip UTSW 9 120,246,207 (GRCm39) missense probably damaging 0.97
R8204:Myrip UTSW 9 120,262,045 (GRCm39) critical splice donor site probably null
R8557:Myrip UTSW 9 120,246,252 (GRCm39) missense probably benign 0.32
R8911:Myrip UTSW 9 120,270,484 (GRCm39) missense possibly damaging 0.94
R9106:Myrip UTSW 9 120,261,544 (GRCm39) missense probably benign 0.37
R9225:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
Z1177:Myrip UTSW 9 120,270,547 (GRCm39) missense probably damaging 1.00
Z1177:Myrip UTSW 9 120,261,844 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGTCAGAGGCTTCCTGC -3'
(R):5'- TCCTTGGTAGGCATCAATGACTTTG -3'

Sequencing Primer
(F):5'- TGCCCCCATCCAAGTGTGAAG -3'
(R):5'- GGAGCTACTATTGTAACCTGGAC -3'
Posted On 2021-07-15