Incidental Mutation 'R8853:Myrip'
ID675128
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Namemyosin VIIA and Rab interacting protein
SynonymsA230081N12Rik, Slac2-c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8853 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location120301513-120474841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120461421 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 702 (A702V)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
Predicted Effect probably damaging
Transcript: ENSMUST00000048121
AA Change: A702V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: A702V

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,906,060 Y290F probably benign Het
Ap5m1 T A 14: 49,073,880 L136M possibly damaging Het
Arpp21 T G 9: 112,147,448 T322P probably damaging Het
Atp6v1c2 C T 12: 17,301,147 V128M possibly damaging Het
C4b A G 17: 34,729,905 V1523A possibly damaging Het
Copg2 G C 6: 30,826,180 L277V probably benign Het
Cyp2b19 A G 7: 26,757,220 T12A possibly damaging Het
D5Ertd579e A T 5: 36,629,680 C115S probably damaging Het
Defb35 G A 8: 21,940,790 R60Q unknown Het
Dlgap3 T A 4: 127,195,017 D135E probably damaging Het
Dync2h1 A T 9: 7,117,645 W2215R possibly damaging Het
Eea1 G C 10: 96,021,655 A660P Het
Egfr A G 11: 16,908,885 I955V possibly damaging Het
Eif3b G A 5: 140,440,019 V655M probably damaging Het
Elp3 T A 14: 65,577,941 I220F probably benign Het
Ern2 A G 7: 122,173,744 V550A probably damaging Het
Evc G A 5: 37,303,303 S857L possibly damaging Het
Glt28d2 T A 3: 85,871,780 M129L probably benign Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hmcn1 A T 1: 150,671,975 Y2742N probably damaging Het
Klhl6 T A 16: 19,947,229 Q541L possibly damaging Het
Myh14 G A 7: 44,616,254 T1559I probably benign Het
Myo7b A G 18: 31,986,691 F783L possibly damaging Het
Ndnf C A 6: 65,703,177 Q147K probably benign Het
Necab2 C G 8: 119,462,600 R170G possibly damaging Het
Nfatc4 T C 14: 55,826,233 I59T probably damaging Het
Nfix A G 8: 84,727,647 S211P probably damaging Het
Nlrp5 A T 7: 23,418,300 Q483L possibly damaging Het
Olfr427 T C 1: 174,100,295 V279A probably damaging Het
Pde4a A G 9: 21,194,823 T245A possibly damaging Het
Peli2 C T 14: 48,256,488 T389M probably damaging Het
Pfas T C 11: 68,992,918 K638E probably damaging Het
Pkhd1 A G 1: 20,073,455 probably null Het
Plch1 T C 3: 63,781,546 D67G probably damaging Het
Plcl2 A T 17: 50,606,856 R298* probably null Het
Ppp1r13l A G 7: 19,369,968 I125V probably benign Het
Ppp2r3a A G 9: 101,212,911 V71A probably benign Het
Pvr A G 7: 19,916,972 V209A possibly damaging Het
Rap1gap2 A G 11: 74,407,372 L414P probably damaging Het
Rasgrp2 A G 19: 6,414,825 D601G probably damaging Het
Reck T A 4: 43,912,089 N199K probably benign Het
Rin2 G T 2: 145,876,555 A652S possibly damaging Het
Rnf34 T C 5: 122,864,024 L88P possibly damaging Het
Serpina3m A G 12: 104,389,655 I194V probably benign Het
Spred3 A G 7: 29,161,990 S255P probably benign Het
Sult2a7 A G 7: 14,491,716 probably null Het
Synpo2l C A 14: 20,661,374 G622C probably damaging Het
Tenm3 A G 8: 48,342,347 C582R probably damaging Het
Tex261 A T 6: 83,773,745 I90N probably damaging Het
Trappc11 A G 8: 47,529,404 F100S probably damaging Het
Trhde G A 10: 114,800,925 P126S probably benign Het
Vmn2r53 A T 7: 12,581,810 V694E probably damaging Het
Vmn2r54 A T 7: 12,615,855 L600Q probably damaging Het
Vwf G A 6: 125,657,264 C2174Y Het
Wee2 A G 6: 40,464,266 T502A probably benign Het
Zfp40 T A 17: 23,175,717 H632L possibly damaging Het
Zmynd11 T C 13: 9,690,929 S378G probably damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120388264 missense probably damaging 1.00
IGL02108:Myrip APN 9 120467565 critical splice donor site probably null
IGL02406:Myrip APN 9 120467532 missense probably benign
IGL02876:Myrip APN 9 120432674 missense probably damaging 1.00
IGL03109:Myrip APN 9 120453724 splice site probably null
IGL03258:Myrip APN 9 120441352 missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120467517 missense probably damaging 0.98
R0485:Myrip UTSW 9 120441377 missense probably benign 0.01
R0633:Myrip UTSW 9 120388236 missense probably damaging 1.00
R1489:Myrip UTSW 9 120432529 missense probably damaging 1.00
R1539:Myrip UTSW 9 120424623 missense probably benign 0.00
R1708:Myrip UTSW 9 120464774 missense possibly damaging 0.65
R1817:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1818:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1878:Myrip UTSW 9 120424655 missense probably damaging 0.99
R2484:Myrip UTSW 9 120424619 missense probably benign 0.00
R3237:Myrip UTSW 9 120441407 missense possibly damaging 0.91
R3890:Myrip UTSW 9 120422258 missense probably damaging 1.00
R3912:Myrip UTSW 9 120432616 missense probably benign
R3919:Myrip UTSW 9 120432629 missense probably damaging 1.00
R4125:Myrip UTSW 9 120464698 nonsense probably null
R4126:Myrip UTSW 9 120464698 nonsense probably null
R4128:Myrip UTSW 9 120464698 nonsense probably null
R4435:Myrip UTSW 9 120335614 start gained probably benign
R4599:Myrip UTSW 9 120464784 missense probably damaging 0.97
R5014:Myrip UTSW 9 120422468 missense probably damaging 1.00
R5665:Myrip UTSW 9 120461433 missense probably damaging 1.00
R5814:Myrip UTSW 9 120424668 missense probably benign 0.06
R5849:Myrip UTSW 9 120453693 missense probably damaging 0.99
R5986:Myrip UTSW 9 120461421 missense probably damaging 1.00
R6706:Myrip UTSW 9 120388293 missense possibly damaging 0.93
R7019:Myrip UTSW 9 120422507 missense probably damaging 1.00
R7291:Myrip UTSW 9 120417141 missense probably damaging 0.97
R8204:Myrip UTSW 9 120432979 critical splice donor site probably null
R8557:Myrip UTSW 9 120417186 missense probably benign 0.32
R8911:Myrip UTSW 9 120441418 missense possibly damaging 0.94
Z1177:Myrip UTSW 9 120432778 missense probably benign
Z1177:Myrip UTSW 9 120441481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTCAGAGGCTTCCTGC -3'
(R):5'- TCCTTGGTAGGCATCAATGACTTTG -3'

Sequencing Primer
(F):5'- TGCCCCCATCCAAGTGTGAAG -3'
(R):5'- GGAGCTACTATTGTAACCTGGAC -3'
Posted On2021-07-15