Incidental Mutation 'R8854:Megf6'
ID675165
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8854 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 154268012 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1276 (T1276M)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably damaging
Transcript: ENSMUST00000030897
AA Change: T1276M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: T1276M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117277
Gene: ENSMUSG00000057751
AA Change: T143M

DomainStartEndE-ValueType
EGF_Lam 3 42 3.1e-2 SMART
EGF 32 73 7.53e-1 SMART
EGF_like 46 85 8.92e-1 SMART
EGF 84 116 7.13e-2 SMART
EGF 127 159 1.73e0 SMART
EGF 170 202 6.55e-1 SMART
EGF 213 245 4.39e-2 SMART
EGF_Lam 261 300 7.64e-2 SMART
EGF 299 331 1.51e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152159
AA Change: T995M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751
AA Change: T995M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,518,638 S273T probably damaging Het
Aldh1a1 G A 19: 20,610,933 W29* probably null Het
Ankib1 C A 5: 3,727,489 W467L probably null Het
Arhgef10 A G 8: 14,979,798 probably null Het
Arpc1b C A 5: 145,123,595 R66S probably benign Het
Atoh1 A T 6: 64,729,205 probably benign Het
Bach2 T A 4: 32,575,263 D619E possibly damaging Het
Bbs9 T C 9: 22,578,764 I277T probably damaging Het
BC027072 T C 17: 71,749,331 Y1117C probably benign Het
Cadps2 G A 6: 23,385,508 P772S probably damaging Het
Cd1d1 T A 3: 86,998,173 D171V probably damaging Het
Clca2 C T 3: 145,078,091 A588T possibly damaging Het
Cps1 A G 1: 67,160,889 K399E probably damaging Het
Cpt1a T C 19: 3,356,327 S98P probably benign Het
Cryzl2 A G 1: 157,458,800 K36R possibly damaging Het
Cxcl13 T C 5: 95,957,002 L11P unknown Het
Dbf4 T A 5: 8,408,562 D151V probably damaging Het
Eogt A T 6: 97,131,398 C227* probably null Het
Fam129a A G 1: 151,709,199 K516E probably damaging Het
Fermt3 T A 19: 7,013,942 D231V probably damaging Het
Il2rb T C 15: 78,485,753 T229A probably benign Het
Ildr1 T A 16: 36,715,548 Y142N probably damaging Het
Kcnv2 A T 19: 27,333,858 T542S probably benign Het
Kif26b G A 1: 178,916,383 G1348E possibly damaging Het
Lancl1 C T 1: 67,034,199 E42K possibly damaging Het
Lrp1 T A 10: 127,543,099 D4010V probably damaging Het
Mark2 A G 19: 7,281,004 V640A probably benign Het
Meioc T C 11: 102,675,763 M735T probably damaging Het
Mfsd4b5 C A 10: 39,970,739 V282L probably damaging Het
Mlx T A 11: 101,091,125 V286E Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Muc1 C T 3: 89,232,105 P604L probably damaging Het
Net1 G T 13: 3,884,214 D548E probably benign Het
Ngly1 T C 14: 16,281,769 S342P probably damaging Het
Nipbl A T 15: 8,300,726 I2405N probably damaging Het
Nkx2-1 A T 12: 56,533,421 C245S probably benign Het
Olfr502 T A 7: 108,523,729 I74L probably benign Het
Olfr598 T C 7: 103,328,816 I110T probably damaging Het
Pcdhgb5 C T 18: 37,732,448 T432I probably benign Het
Plpp4 T A 7: 129,307,638 L24* probably null Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Sass6 C A 3: 116,605,735 Q93K possibly damaging Het
Sirpb1c T C 3: 15,833,144 N177S possibly damaging Het
Slc22a30 A G 19: 8,386,390 probably null Het
Snd1 A G 6: 28,526,969 H217R probably benign Het
Spata31d1c C A 13: 65,035,990 Q449K possibly damaging Het
Spidr A G 16: 15,889,766 V889A probably damaging Het
Suclg2 A T 6: 95,595,669 V105D probably damaging Het
Syne1 A T 10: 5,128,503 M974K probably benign Het
Tbrg4 A T 11: 6,616,691 D605E probably benign Het
Tcn2 A G 11: 3,926,074 F118S possibly damaging Het
Tfap4 T C 16: 4,549,374 H208R probably benign Het
Trpc4 A T 3: 54,194,701 K7* probably null Het
Uap1 G T 1: 170,149,415 P405Q probably damaging Het
Usp33 C A 3: 152,368,330 T271N probably benign Het
Usp42 T C 5: 143,716,877 D663G possibly damaging Het
Vmn2r10 T C 5: 108,996,260 D608G probably benign Het
Wfdc16 G A 2: 164,638,566 P3L probably benign Het
Zfp28 T C 7: 6,394,939 I791T probably benign Het
Zfp970 A T 2: 177,473,295 T5S probably damaging Het
Zfy1 A T Y: 726,501 H421Q possibly damaging Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 splice site probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
R8175:Megf6 UTSW 4 154268619 nonsense probably null
R8231:Megf6 UTSW 4 154252518 missense probably damaging 1.00
R8436:Megf6 UTSW 4 154265192 missense probably damaging 1.00
R8460:Megf6 UTSW 4 154266177 nonsense probably null
R8738:Megf6 UTSW 4 154267979 missense probably benign
R8896:Megf6 UTSW 4 154242403 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCATTCTGGTATGTAAGGTAGAG -3'
(R):5'- CGTCCTCAAAGCCACTCTAG -3'

Sequencing Primer
(F):5'- TAAGGTAGAGGGGGCAGCTCTC -3'
(R):5'- TTAACAGGGAACTCGAGAGTCC -3'
Posted On2021-07-15