Incidental Mutation 'R8854:Meioc'
ID 675190
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R8854 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102675763 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 735 (M735T)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably damaging
Transcript: ENSMUST00000100378
AA Change: M735T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: M735T

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156590
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,518,638 S273T probably damaging Het
Aldh1a1 G A 19: 20,610,933 W29* probably null Het
Ankib1 C A 5: 3,727,489 W467L probably null Het
Arhgef10 A G 8: 14,979,798 probably null Het
Arpc1b C A 5: 145,123,595 R66S probably benign Het
Atoh1 A T 6: 64,729,205 probably benign Het
Bach2 T A 4: 32,575,263 D619E possibly damaging Het
Bbs9 T C 9: 22,578,764 I277T probably damaging Het
BC027072 T C 17: 71,749,331 Y1117C probably benign Het
Cadps2 G A 6: 23,385,508 P772S probably damaging Het
Cd1d1 T A 3: 86,998,173 D171V probably damaging Het
Clca2 C T 3: 145,078,091 A588T possibly damaging Het
Cps1 A G 1: 67,160,889 K399E probably damaging Het
Cpt1a T C 19: 3,356,327 S98P probably benign Het
Cryzl2 A G 1: 157,458,800 K36R possibly damaging Het
Cxcl13 T C 5: 95,957,002 L11P unknown Het
Dbf4 T A 5: 8,408,562 D151V probably damaging Het
Eogt A T 6: 97,131,398 C227* probably null Het
Fam129a A G 1: 151,709,199 K516E probably damaging Het
Fermt3 T A 19: 7,013,942 D231V probably damaging Het
Gm21761 T A 13: 119,916,289 probably benign Het
Il2rb T C 15: 78,485,753 T229A probably benign Het
Ildr1 T A 16: 36,715,548 Y142N probably damaging Het
Kcnv2 A T 19: 27,333,858 T542S probably benign Het
Kif26b G A 1: 178,916,383 G1348E possibly damaging Het
Lancl1 C T 1: 67,034,199 E42K possibly damaging Het
Lrp1 T A 10: 127,543,099 D4010V probably damaging Het
Mark2 A G 19: 7,281,004 V640A probably benign Het
Megf6 C T 4: 154,268,012 T1276M probably damaging Het
Mfsd4b5 C A 10: 39,970,739 V282L probably damaging Het
Mlx T A 11: 101,091,125 V286E Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Muc1 C T 3: 89,232,105 P604L probably damaging Het
Net1 G T 13: 3,884,214 D548E probably benign Het
Ngly1 T C 14: 16,281,769 S342P probably damaging Het
Nipbl A T 15: 8,300,726 I2405N probably damaging Het
Nkx2-1 A T 12: 56,533,421 C245S probably benign Het
Olfr502 T A 7: 108,523,729 I74L probably benign Het
Olfr598 T C 7: 103,328,816 I110T probably damaging Het
Pcdhgb5 C T 18: 37,732,448 T432I probably benign Het
Plpp4 T A 7: 129,307,638 L24* probably null Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Sass6 C A 3: 116,605,735 Q93K possibly damaging Het
Sirpb1c T C 3: 15,833,144 N177S possibly damaging Het
Slc22a30 A G 19: 8,386,390 probably null Het
Snd1 A G 6: 28,526,969 H217R probably benign Het
Spata31d1c C A 13: 65,035,990 Q449K possibly damaging Het
Spidr A G 16: 15,889,766 V889A probably damaging Het
Suclg2 A T 6: 95,595,669 V105D probably damaging Het
Syne1 A T 10: 5,128,503 M974K probably benign Het
Tbrg4 A T 11: 6,616,691 D605E probably benign Het
Tcn2 A G 11: 3,926,074 F118S possibly damaging Het
Tfap4 T C 16: 4,549,374 H208R probably benign Het
Trf A G 9: 103,230,330 probably benign Het
Trpc4 A T 3: 54,194,701 K7* probably null Het
Uap1 G T 1: 170,149,415 P405Q probably damaging Het
Usp33 C A 3: 152,368,330 T271N probably benign Het
Usp42 T C 5: 143,716,877 D663G possibly damaging Het
Vmn2r10 T C 5: 108,996,260 D608G probably benign Het
Wfdc16 G A 2: 164,638,566 P3L probably benign Het
Zfp28 T C 7: 6,394,939 I791T probably benign Het
Zfp970 A T 2: 177,473,295 T5S probably damaging Het
Zfy1 A T Y: 726,501 H421Q possibly damaging Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5301:Meioc UTSW 11 102680045 missense probably damaging 1.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R5968:Meioc UTSW 11 102675831 missense probably damaging 0.99
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6410:Meioc UTSW 11 102675034 missense probably benign 0.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7815:Meioc UTSW 11 102675588 missense probably damaging 1.00
R7984:Meioc UTSW 11 102674606 missense possibly damaging 0.94
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8078:Meioc UTSW 11 102668400 nonsense probably null
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8797:Meioc UTSW 11 102676860 nonsense probably null
R8891:Meioc UTSW 11 102668420 missense probably benign 0.43
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTTAATAGCCACAGACAAGGAAGTGG -3'
(R):5'- TGGACTGAACACACTGTTACTTC -3'

Sequencing Primer
(F):5'- GTGAATCGCACACAGGCCTC -3'
(R):5'- CTGAACACACTGTTACTTCTAAATGG -3'
Posted On 2021-07-15