Incidental Mutation 'R8854:Tfap4'
ID675198
Institutional Source Beutler Lab
Gene Symbol Tfap4
Ensembl Gene ENSMUSG00000005718
Gene Nametranscription factor AP4
SynonymsAP-4, bHLHc41, Tcfap4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock #R8854 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location4544661-4559854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4549374 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 208 (H208R)
Ref Sequence ENSEMBL: ENSMUSP00000005862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005862] [ENSMUST00000229956] [ENSMUST00000230875]
Predicted Effect probably benign
Transcript: ENSMUST00000005862
AA Change: H208R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005862
Gene: ENSMUSG00000005718
AA Change: H208R

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
HLH 54 105 2.06e-16 SMART
coiled coil region 144 183 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229956
AA Change: H188R

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000230875
AA Change: H148R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription factors of the basic helix-loop-helix-zipper (bHLH-ZIP) family contain a basic domain, which is used for DNA binding, and HLH and ZIP domains, which are used for oligomerization. Transcription factor AP4 activates both viral and cellular genes by binding to the symmetrical DNA sequence CAGCTG (Mermod et al., 1988 [PubMed 2833704]; Hu et al., 1990 [PubMed 2123466]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality and reduced suppression of Cd4 in double negative thymocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,518,638 S273T probably damaging Het
Aldh1a1 G A 19: 20,610,933 W29* probably null Het
Ankib1 C A 5: 3,727,489 W467L probably null Het
Arhgef10 A G 8: 14,979,798 probably null Het
Arpc1b C A 5: 145,123,595 R66S probably benign Het
Atoh1 A T 6: 64,729,205 probably benign Het
Bach2 T A 4: 32,575,263 D619E possibly damaging Het
Bbs9 T C 9: 22,578,764 I277T probably damaging Het
BC027072 T C 17: 71,749,331 Y1117C probably benign Het
Cadps2 G A 6: 23,385,508 P772S probably damaging Het
Cd1d1 T A 3: 86,998,173 D171V probably damaging Het
Clca2 C T 3: 145,078,091 A588T possibly damaging Het
Cps1 A G 1: 67,160,889 K399E probably damaging Het
Cpt1a T C 19: 3,356,327 S98P probably benign Het
Cryzl2 A G 1: 157,458,800 K36R possibly damaging Het
Cxcl13 T C 5: 95,957,002 L11P unknown Het
Dbf4 T A 5: 8,408,562 D151V probably damaging Het
Eogt A T 6: 97,131,398 C227* probably null Het
Fam129a A G 1: 151,709,199 K516E probably damaging Het
Fermt3 T A 19: 7,013,942 D231V probably damaging Het
Il2rb T C 15: 78,485,753 T229A probably benign Het
Ildr1 T A 16: 36,715,548 Y142N probably damaging Het
Kcnv2 A T 19: 27,333,858 T542S probably benign Het
Kif26b G A 1: 178,916,383 G1348E possibly damaging Het
Lancl1 C T 1: 67,034,199 E42K possibly damaging Het
Lrp1 T A 10: 127,543,099 D4010V probably damaging Het
Mark2 A G 19: 7,281,004 V640A probably benign Het
Megf6 C T 4: 154,268,012 T1276M probably damaging Het
Meioc T C 11: 102,675,763 M735T probably damaging Het
Mfsd4b5 C A 10: 39,970,739 V282L probably damaging Het
Mlx T A 11: 101,091,125 V286E Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Muc1 C T 3: 89,232,105 P604L probably damaging Het
Net1 G T 13: 3,884,214 D548E probably benign Het
Ngly1 T C 14: 16,281,769 S342P probably damaging Het
Nipbl A T 15: 8,300,726 I2405N probably damaging Het
Nkx2-1 A T 12: 56,533,421 C245S probably benign Het
Olfr502 T A 7: 108,523,729 I74L probably benign Het
Olfr598 T C 7: 103,328,816 I110T probably damaging Het
Pcdhgb5 C T 18: 37,732,448 T432I probably benign Het
Plpp4 T A 7: 129,307,638 L24* probably null Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Sass6 C A 3: 116,605,735 Q93K possibly damaging Het
Sirpb1c T C 3: 15,833,144 N177S possibly damaging Het
Slc22a30 A G 19: 8,386,390 probably null Het
Snd1 A G 6: 28,526,969 H217R probably benign Het
Spata31d1c C A 13: 65,035,990 Q449K possibly damaging Het
Spidr A G 16: 15,889,766 V889A probably damaging Het
Suclg2 A T 6: 95,595,669 V105D probably damaging Het
Syne1 A T 10: 5,128,503 M974K probably benign Het
Tbrg4 A T 11: 6,616,691 D605E probably benign Het
Tcn2 A G 11: 3,926,074 F118S possibly damaging Het
Trpc4 A T 3: 54,194,701 K7* probably null Het
Uap1 G T 1: 170,149,415 P405Q probably damaging Het
Usp33 C A 3: 152,368,330 T271N probably benign Het
Usp42 T C 5: 143,716,877 D663G possibly damaging Het
Vmn2r10 T C 5: 108,996,260 D608G probably benign Het
Wfdc16 G A 2: 164,638,566 P3L probably benign Het
Zfp28 T C 7: 6,394,939 I791T probably benign Het
Zfp970 A T 2: 177,473,295 T5S probably damaging Het
Zfy1 A T Y: 726,501 H421Q possibly damaging Het
Other mutations in Tfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Tfap4 APN 16 4547359 missense probably damaging 1.00
IGL01816:Tfap4 APN 16 4552092 missense probably damaging 0.98
IGL02947:Tfap4 APN 16 4551360 missense probably damaging 0.99
E0370:Tfap4 UTSW 16 4559470 missense possibly damaging 0.53
R1311:Tfap4 UTSW 16 4559426 critical splice donor site probably null
R1791:Tfap4 UTSW 16 4552069 missense possibly damaging 0.53
R4300:Tfap4 UTSW 16 4551360 missense probably damaging 0.99
R4371:Tfap4 UTSW 16 4551999 missense probably damaging 1.00
R5945:Tfap4 UTSW 16 4545629 missense possibly damaging 0.53
R6219:Tfap4 UTSW 16 4547311 missense probably damaging 0.96
R6738:Tfap4 UTSW 16 4549447 missense probably damaging 0.99
R7678:Tfap4 UTSW 16 4551766 missense possibly damaging 0.53
R8496:Tfap4 UTSW 16 4551306 missense probably damaging 0.99
R8928:Tfap4 UTSW 16 4551354 missense probably damaging 0.99
X0065:Tfap4 UTSW 16 4547276 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACAGCTAAAACGCAGCATG -3'
(R):5'- ACCAGCTAGTCAGTCAGAAGG -3'

Sequencing Primer
(F):5'- ATGCCTGCACAGCTATTTGTAC -3'
(R):5'- AAGGGGAGAGCCTTCCGTC -3'
Posted On2021-07-15