Incidental Mutation 'R8855:Cdk5rap2'
ID675227
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R8855 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70300650 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 623 (D623E)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably damaging
Transcript: ENSMUST00000144099
AA Change: D623E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: D623E

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Ace T A 11: 105,970,598 L191* probably null Het
Ahctf1 G A 1: 179,786,776 H451Y probably damaging Het
Amotl1 C A 9: 14,555,573 probably null Het
Angptl6 T A 9: 20,875,644 Y261F probably damaging Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
B4galnt4 G A 7: 141,068,575 G668D possibly damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Cenpf C A 1: 189,653,233 K2283N probably benign Het
Clec16a A T 16: 10,644,867 D683V probably damaging Het
Clvs2 T C 10: 33,528,404 D272G probably benign Het
Cnksr1 A G 4: 134,232,183 V380A probably damaging Het
Col20a1 C A 2: 181,013,891 P42T Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dennd4a G A 9: 64,912,390 G1761D probably benign Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Enpp7 A G 11: 118,988,365 N50S possibly damaging Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Flt1 A T 5: 147,570,872 D1209E probably benign Het
Flt1 A T 5: 147,681,650 N260K probably damaging Het
Fras1 A G 5: 96,769,606 H3495R Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Gja10 A T 4: 32,601,573 C270* probably null Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Gsta2 T C 9: 78,337,598 K78R probably damaging Het
Gtf3a A G 5: 146,948,911 D44G probably benign Het
Hap1 C A 11: 100,356,038 G14W probably damaging Het
Hcn4 T A 9: 58,858,104 I623N unknown Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Kmt2d A T 15: 98,856,356 L1622Q unknown Het
Lipi T A 16: 75,558,593 D343V probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mamstr A T 7: 45,644,979 D419V probably benign Het
Map2k7 C T 8: 4,243,594 T119I probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Mrps24 A T 11: 5,704,642 L104Q probably damaging Het
Myh1 T A 11: 67,211,421 L846H probably damaging Het
Ndufaf5 T A 2: 140,183,920 I133N possibly damaging Het
Ndufs5 A G 4: 123,715,862 probably null Het
Numa1 G C 7: 101,990,628 D62H possibly damaging Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr551 G T 7: 102,588,738 Q2K probably benign Het
Olfr596 T A 7: 103,309,961 I80N probably damaging Het
Olfr876 C G 9: 37,804,413 F167L probably damaging Het
Pag1 T C 3: 9,699,469 K208R probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Plekhg2 T C 7: 28,370,101 T144A probably benign Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Pramef17 A T 4: 143,994,335 L12Q probably damaging Het
Prpf4 A G 4: 62,415,998 D230G probably benign Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Sec16a G A 2: 26,439,840 T721I probably benign Het
Serpinb6c A T 13: 33,899,326 I35N probably damaging Het
Sgk1 T G 10: 21,995,827 S181A probably benign Het
Slc25a10 T C 11: 120,494,969 S74P probably damaging Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Snapc4 G A 2: 26,374,533 R265W probably damaging Het
Taar1 C T 10: 23,921,078 R225C possibly damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Trank1 T C 9: 111,312,221 V127A unknown Het
Trim66 G T 7: 109,481,981 H244N probably damaging Het
Tshz2 T A 2: 169,886,505 L1007H probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfand1 T C 3: 10,340,751 D264G probably benign Het
Zfp839 A G 12: 110,868,414 E701G probably benign Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70380273 missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70239325 missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70245510 splice site probably benign
R8782:Cdk5rap2 UTSW 4 70243475 missense possibly damaging 0.57
R8965:Cdk5rap2 UTSW 4 70266805 missense probably benign 0.30
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGCTCCATGCATGTAAGAAGCC -3'
(R):5'- AACCCATCCCCTTGCAATTG -3'

Sequencing Primer
(F):5'- TGTAAGAAGCCATGCAGCAATTC -3'
(R):5'- CCCTTGCAATTGCTTTGGGTAAAAG -3'
Posted On2021-07-15