Incidental Mutation 'R8855:Olfr596'
ID675246
Institutional Source Beutler Lab
Gene Symbol Olfr596
Ensembl Gene ENSMUSG00000073953
Gene Nameolfactory receptor 596
SynonymsOlfr596-ps1, Gm15117, ENSMUSG00000073953, GA_x6K02T2PBJ9-6019769-6019943
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8855 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103305648-103312782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103309961 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 80 (I80N)
Ref Sequence ENSEMBL: ENSMUSP00000149187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104880] [ENSMUST00000214577]
Predicted Effect probably damaging
Transcript: ENSMUST00000104880
AA Change: I80N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100475
Gene: ENSMUSG00000073953
AA Change: I80N

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 210 5.1e-11 PFAM
Pfam:7tm_1 43 293 1.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214577
AA Change: I80N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Ace T A 11: 105,970,598 L191* probably null Het
Ahctf1 G A 1: 179,786,776 H451Y probably damaging Het
Amotl1 C A 9: 14,555,573 probably null Het
Angptl6 T A 9: 20,875,644 Y261F probably damaging Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
B4galnt4 G A 7: 141,068,575 G668D possibly damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Cdk5rap2 A T 4: 70,300,650 D623E probably damaging Het
Cenpf C A 1: 189,653,233 K2283N probably benign Het
Clec16a A T 16: 10,644,867 D683V probably damaging Het
Clvs2 T C 10: 33,528,404 D272G probably benign Het
Cnksr1 A G 4: 134,232,183 V380A probably damaging Het
Col20a1 C A 2: 181,013,891 P42T Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dennd4a G A 9: 64,912,390 G1761D probably benign Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Enpp7 A G 11: 118,988,365 N50S possibly damaging Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Flt1 A T 5: 147,570,872 D1209E probably benign Het
Flt1 A T 5: 147,681,650 N260K probably damaging Het
Fras1 A G 5: 96,769,606 H3495R Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Gja10 A T 4: 32,601,573 C270* probably null Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Gsta2 T C 9: 78,337,598 K78R probably damaging Het
Gtf3a A G 5: 146,948,911 D44G probably benign Het
Hap1 C A 11: 100,356,038 G14W probably damaging Het
Hcn4 T A 9: 58,858,104 I623N unknown Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Kmt2d A T 15: 98,856,356 L1622Q unknown Het
Lipi T A 16: 75,558,593 D343V probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mamstr A T 7: 45,644,979 D419V probably benign Het
Map2k7 C T 8: 4,243,594 T119I probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Mrps24 A T 11: 5,704,642 L104Q probably damaging Het
Myh1 T A 11: 67,211,421 L846H probably damaging Het
Ndufaf5 T A 2: 140,183,920 I133N possibly damaging Het
Ndufs5 A G 4: 123,715,862 probably null Het
Numa1 G C 7: 101,990,628 D62H possibly damaging Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr551 G T 7: 102,588,738 Q2K probably benign Het
Olfr876 C G 9: 37,804,413 F167L probably damaging Het
Pag1 T C 3: 9,699,469 K208R probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Plekhg2 T C 7: 28,370,101 T144A probably benign Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Pramef17 A T 4: 143,994,335 L12Q probably damaging Het
Prpf4 A G 4: 62,415,998 D230G probably benign Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Sec16a G A 2: 26,439,840 T721I probably benign Het
Serpinb6c A T 13: 33,899,326 I35N probably damaging Het
Sgk1 T G 10: 21,995,827 S181A probably benign Het
Slc25a10 T C 11: 120,494,969 S74P probably damaging Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Snapc4 G A 2: 26,374,533 R265W probably damaging Het
Taar1 C T 10: 23,921,078 R225C possibly damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Trank1 T C 9: 111,312,221 V127A unknown Het
Trim66 G T 7: 109,481,981 H244N probably damaging Het
Tshz2 T A 2: 169,886,505 L1007H probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfand1 T C 3: 10,340,751 D264G probably benign Het
Zfp839 A G 12: 110,868,414 E701G probably benign Het
Other mutations in Olfr596
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Olfr596 APN 7 103309807 missense probably benign 0.03
IGL01917:Olfr596 APN 7 103310357 nonsense probably null
G1patch:Olfr596 UTSW 7 103310354 missense probably damaging 1.00
R0601:Olfr596 UTSW 7 103310164 missense probably damaging 1.00
R0908:Olfr596 UTSW 7 103310573 missense possibly damaging 0.56
R1762:Olfr596 UTSW 7 103310221 missense probably damaging 1.00
R1772:Olfr596 UTSW 7 103310242 missense possibly damaging 0.94
R1806:Olfr596 UTSW 7 103310225 missense probably damaging 1.00
R2035:Olfr596 UTSW 7 103310256 missense probably damaging 1.00
R2365:Olfr596 UTSW 7 103310173 missense probably benign 0.00
R3827:Olfr596 UTSW 7 103309802 missense probably benign 0.12
R4241:Olfr596 UTSW 7 103310661 makesense probably null
R4619:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R4620:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R6279:Olfr596 UTSW 7 103310429 missense probably benign
R6300:Olfr596 UTSW 7 103310429 missense probably benign
R6505:Olfr596 UTSW 7 103309793 missense probably benign 0.00
R6725:Olfr596 UTSW 7 103310354 missense probably damaging 1.00
R7175:Olfr596 UTSW 7 103309847 missense probably benign 0.22
R7708:Olfr596 UTSW 7 103310561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGGCTGGAAGCTTTC -3'
(R):5'- ACAGGTCTCCCTATTACAACCG -3'

Sequencing Primer
(F):5'- CCATATCTGGATAGCCTTTCCTTTC -3'
(R):5'- CCACCACTTTGTTGGTGAGAATAGAG -3'
Posted On2021-07-15