Incidental Mutation 'R8855:Trim66'
ID 675247
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Name tripartite motif-containing 66
Synonyms Tif1d, D7H11orf29
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R8855 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109449006-109508134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 109481981 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 244 (H244N)
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
AlphaFold Q924W6
Predicted Effect probably damaging
Transcript: ENSMUST00000033339
AA Change: H142N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: H142N

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106739
AA Change: H142N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: H142N

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106741
AA Change: H244N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: H244N

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Ace T A 11: 105,970,598 L191* probably null Het
Ahctf1 G A 1: 179,786,776 H451Y probably damaging Het
Amotl1 C A 9: 14,555,573 probably null Het
Angptl6 T A 9: 20,875,644 Y261F probably damaging Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
B4galnt4 G A 7: 141,068,575 G668D possibly damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Cdk5rap2 A T 4: 70,300,650 D623E probably damaging Het
Cenpf C A 1: 189,653,233 K2283N probably benign Het
Clec16a A T 16: 10,644,867 D683V probably damaging Het
Clvs2 T C 10: 33,528,404 D272G probably benign Het
Cnksr1 A G 4: 134,232,183 V380A probably damaging Het
Col20a1 C A 2: 181,013,891 P42T Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dennd4a G A 9: 64,912,390 G1761D probably benign Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Enpp7 A G 11: 118,988,365 N50S possibly damaging Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Flt1 A T 5: 147,570,872 D1209E probably benign Het
Flt1 A T 5: 147,681,650 N260K probably damaging Het
Fras1 A G 5: 96,769,606 H3495R Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Gja10 A T 4: 32,601,573 C270* probably null Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Gsta2 T C 9: 78,337,598 K78R probably damaging Het
Gtf3a A G 5: 146,948,911 D44G probably benign Het
Hap1 C A 11: 100,356,038 G14W probably damaging Het
Hcn4 T A 9: 58,858,104 I623N unknown Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Kmt2d A T 15: 98,856,356 L1622Q unknown Het
Lipi T A 16: 75,558,593 D343V probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mamstr A T 7: 45,644,979 D419V probably benign Het
Map2k7 C T 8: 4,243,594 T119I probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Mrps24 A T 11: 5,704,642 L104Q probably damaging Het
Myh1 T A 11: 67,211,421 L846H probably damaging Het
Ndufaf5 T A 2: 140,183,920 I133N possibly damaging Het
Ndufs5 A G 4: 123,715,862 probably null Het
Numa1 G C 7: 101,990,628 D62H possibly damaging Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr551 G T 7: 102,588,738 Q2K probably benign Het
Olfr596 T A 7: 103,309,961 I80N probably damaging Het
Olfr876 C G 9: 37,804,413 F167L probably damaging Het
Pag1 T C 3: 9,699,469 K208R probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Plekhg2 T C 7: 28,370,101 T144A probably benign Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Pramef17 A T 4: 143,994,335 L12Q probably damaging Het
Prpf4 A G 4: 62,415,998 D230G probably benign Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Sec16a G A 2: 26,439,840 T721I probably benign Het
Serpinb6c A T 13: 33,899,326 I35N probably damaging Het
Sgk1 T G 10: 21,995,827 S181A probably benign Het
Slc25a10 T C 11: 120,494,969 S74P probably damaging Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Snapc4 G A 2: 26,374,533 R265W probably damaging Het
Taar1 C T 10: 23,921,078 R225C possibly damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Trank1 T C 9: 111,312,221 V127A unknown Het
Tshz2 T A 2: 169,886,505 L1007H probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfand1 T C 3: 10,340,751 D264G probably benign Het
Zfp839 A G 12: 110,868,414 E701G probably benign Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109455066 missense probably benign 0.02
IGL01758:Trim66 APN 7 109486045 critical splice donor site probably null
IGL01982:Trim66 APN 7 109458763 missense probably benign 0.00
IGL01983:Trim66 APN 7 109458251 nonsense probably null
IGL02149:Trim66 APN 7 109460902 missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109460274 missense probably benign 0.01
IGL02483:Trim66 APN 7 109477630 splice site probably benign
IGL02832:Trim66 APN 7 109460497 missense probably damaging 1.00
IGL02945:Trim66 APN 7 109460176 nonsense probably null
IGL03085:Trim66 APN 7 109458745 missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109475247 missense probably damaging 0.99
R0326:Trim66 UTSW 7 109460172 missense probably benign 0.00
R0358:Trim66 UTSW 7 109460176 nonsense probably null
R0401:Trim66 UTSW 7 109475264 missense probably damaging 0.98
R0470:Trim66 UTSW 7 109457542 splice site probably benign
R0568:Trim66 UTSW 7 109460695 missense probably benign 0.00
R0669:Trim66 UTSW 7 109454992 intron probably benign
R0980:Trim66 UTSW 7 109455670 missense probably damaging 1.00
R1015:Trim66 UTSW 7 109455233 missense probably damaging 1.00
R1078:Trim66 UTSW 7 109472319 missense probably damaging 1.00
R1099:Trim66 UTSW 7 109475454 missense probably benign 0.34
R1181:Trim66 UTSW 7 109484577 critical splice donor site probably null
R1497:Trim66 UTSW 7 109484619 missense probably benign 0.00
R1583:Trim66 UTSW 7 109455080 missense probably damaging 1.00
R1843:Trim66 UTSW 7 109475839 missense probably damaging 0.99
R1998:Trim66 UTSW 7 109484577 critical splice donor site probably null
R2016:Trim66 UTSW 7 109472232 critical splice donor site probably null
R2143:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2144:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2145:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R3945:Trim66 UTSW 7 109472268 missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109458131 missense probably damaging 0.98
R4464:Trim66 UTSW 7 109477690 missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109481995 missense probably damaging 1.00
R4729:Trim66 UTSW 7 109456060 critical splice donor site probably null
R4730:Trim66 UTSW 7 109483069 missense probably damaging 1.00
R4775:Trim66 UTSW 7 109457589 nonsense probably null
R4819:Trim66 UTSW 7 109457586 missense probably damaging 1.00
R5269:Trim66 UTSW 7 109457590 missense probably benign 0.00
R5557:Trim66 UTSW 7 109483737 missense probably benign 0.06
R5832:Trim66 UTSW 7 109455202 missense probably damaging 1.00
R6220:Trim66 UTSW 7 109483093 missense probably damaging 0.97
R6243:Trim66 UTSW 7 109460274 missense probably benign 0.01
R6374:Trim66 UTSW 7 109486062 missense probably benign
R6450:Trim66 UTSW 7 109460738 missense probably benign 0.09
R6543:Trim66 UTSW 7 109475879 missense probably benign 0.01
R6788:Trim66 UTSW 7 109477754 missense probably damaging 1.00
R6842:Trim66 UTSW 7 109460776 missense probably benign 0.00
R7169:Trim66 UTSW 7 109455121 missense probably benign 0.25
R7257:Trim66 UTSW 7 109460244 missense probably damaging 1.00
R7328:Trim66 UTSW 7 109457751 missense probably damaging 0.99
R7616:Trim66 UTSW 7 109483749 missense probably damaging 0.99
R8423:Trim66 UTSW 7 109475392 missense possibly damaging 0.77
R9130:Trim66 UTSW 7 109477689 missense possibly damaging 0.90
R9137:Trim66 UTSW 7 109475123 missense probably damaging 0.99
RF013:Trim66 UTSW 7 109460753 missense probably damaging 0.99
RF024:Trim66 UTSW 7 109460740 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCCACTCTCTCAGAATTAGACCAG -3'
(R):5'- AGGTTTACCCAGACGAAGCC -3'

Sequencing Primer
(F):5'- TAGAGTGTGCATCAAAGTTGCTAC -3'
(R):5'- TTTACCCAGACGAAGCCCAGTTAG -3'
Posted On 2021-07-15