Incidental Mutation 'R8855:Zfp839'
ID 675269
Institutional Source Beutler Lab
Gene Symbol Zfp839
Ensembl Gene ENSMUSG00000021271
Gene Name zinc finger protein 839
Synonyms 2810455K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8855 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 110850253-110869996 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110868414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 701 (E701G)
Ref Sequence ENSEMBL: ENSMUSP00000131841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043716] [ENSMUST00000170060] [ENSMUST00000220607] [ENSMUST00000222460]
AlphaFold E9PUU5
Predicted Effect probably benign
Transcript: ENSMUST00000043716
SMART Domains Protein: ENSMUSP00000035245
Gene: ENSMUSG00000021276

DomainStartEndE-ValueType
low complexity region 54 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170060
AA Change: E701G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131841
Gene: ENSMUSG00000021271
AA Change: E701G

DomainStartEndE-ValueType
low complexity region 271 278 N/A INTRINSIC
ZnF_C2H2 295 320 3.02e0 SMART
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220607
Predicted Effect probably benign
Transcript: ENSMUST00000222460
AA Change: E625G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Ace T A 11: 105,970,598 L191* probably null Het
Ahctf1 G A 1: 179,786,776 H451Y probably damaging Het
Amotl1 C A 9: 14,555,573 probably null Het
Angptl6 T A 9: 20,875,644 Y261F probably damaging Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
B4galnt4 G A 7: 141,068,575 G668D possibly damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Cdk5rap2 A T 4: 70,300,650 D623E probably damaging Het
Cenpf C A 1: 189,653,233 K2283N probably benign Het
Clec16a A T 16: 10,644,867 D683V probably damaging Het
Clvs2 T C 10: 33,528,404 D272G probably benign Het
Cnksr1 A G 4: 134,232,183 V380A probably damaging Het
Col20a1 C A 2: 181,013,891 P42T Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dennd4a G A 9: 64,912,390 G1761D probably benign Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Enpp7 A G 11: 118,988,365 N50S possibly damaging Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Flt1 A T 5: 147,570,872 D1209E probably benign Het
Flt1 A T 5: 147,681,650 N260K probably damaging Het
Fras1 A G 5: 96,769,606 H3495R Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Gja10 A T 4: 32,601,573 C270* probably null Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Gsta2 T C 9: 78,337,598 K78R probably damaging Het
Gtf3a A G 5: 146,948,911 D44G probably benign Het
Hap1 C A 11: 100,356,038 G14W probably damaging Het
Hcn4 T A 9: 58,858,104 I623N unknown Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Kmt2d A T 15: 98,856,356 L1622Q unknown Het
Lipi T A 16: 75,558,593 D343V probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mamstr A T 7: 45,644,979 D419V probably benign Het
Map2k7 C T 8: 4,243,594 T119I probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Mrps24 A T 11: 5,704,642 L104Q probably damaging Het
Myh1 T A 11: 67,211,421 L846H probably damaging Het
Ndufaf5 T A 2: 140,183,920 I133N possibly damaging Het
Ndufs5 A G 4: 123,715,862 probably null Het
Numa1 G C 7: 101,990,628 D62H possibly damaging Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr551 G T 7: 102,588,738 Q2K probably benign Het
Olfr596 T A 7: 103,309,961 I80N probably damaging Het
Olfr876 C G 9: 37,804,413 F167L probably damaging Het
Pag1 T C 3: 9,699,469 K208R probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Plekhg2 T C 7: 28,370,101 T144A probably benign Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Pramef17 A T 4: 143,994,335 L12Q probably damaging Het
Prpf4 A G 4: 62,415,998 D230G probably benign Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Sec16a G A 2: 26,439,840 T721I probably benign Het
Serpinb6c A T 13: 33,899,326 I35N probably damaging Het
Sgk1 T G 10: 21,995,827 S181A probably benign Het
Slc25a10 T C 11: 120,494,969 S74P probably damaging Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Snapc4 G A 2: 26,374,533 R265W probably damaging Het
Taar1 C T 10: 23,921,078 R225C possibly damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Trank1 T C 9: 111,312,221 V127A unknown Het
Trim66 G T 7: 109,481,981 H244N probably damaging Het
Tshz2 T A 2: 169,886,505 L1007H probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfand1 T C 3: 10,340,751 D264G probably benign Het
Other mutations in Zfp839
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp839 APN 12 110865007 critical splice donor site probably null
IGL00941:Zfp839 APN 12 110860948 missense probably damaging 1.00
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0109:Zfp839 UTSW 12 110860874 missense possibly damaging 0.92
R0116:Zfp839 UTSW 12 110858769 intron probably benign
R1219:Zfp839 UTSW 12 110868273 missense possibly damaging 0.63
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1434:Zfp839 UTSW 12 110860899 missense probably benign 0.08
R1653:Zfp839 UTSW 12 110855250 missense probably benign 0.02
R1754:Zfp839 UTSW 12 110855457 missense probably damaging 0.98
R2182:Zfp839 UTSW 12 110868338 missense probably damaging 1.00
R3765:Zfp839 UTSW 12 110855163 missense probably benign 0.22
R3981:Zfp839 UTSW 12 110866331 missense probably damaging 0.97
R4756:Zfp839 UTSW 12 110855201 missense possibly damaging 0.92
R5088:Zfp839 UTSW 12 110868176 missense probably damaging 0.99
R5394:Zfp839 UTSW 12 110855586 missense probably benign 0.05
R5619:Zfp839 UTSW 12 110864036 missense probably damaging 1.00
R6856:Zfp839 UTSW 12 110866761 nonsense probably null
R7661:Zfp839 UTSW 12 110868792 missense probably benign 0.32
R7860:Zfp839 UTSW 12 110855626 missense probably damaging 1.00
R8022:Zfp839 UTSW 12 110855098 missense probably damaging 1.00
R8866:Zfp839 UTSW 12 110868414 missense probably benign 0.06
R8896:Zfp839 UTSW 12 110868843 missense probably damaging 1.00
R9289:Zfp839 UTSW 12 110868444 missense probably benign 0.04
R9606:Zfp839 UTSW 12 110868342 missense probably benign
R9668:Zfp839 UTSW 12 110855846 missense probably damaging 0.98
R9686:Zfp839 UTSW 12 110855498 missense probably damaging 1.00
Z1177:Zfp839 UTSW 12 110866784 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCTGCTAGTGACAGAAATGC -3'
(R):5'- TTATGGAGTGGAACGGCTGC -3'

Sequencing Primer
(F):5'- TAGTGACAGAAATGCACCACCTG -3'
(R):5'- AGCCTCTGCCAGAAGGACATG -3'
Posted On 2021-07-15