Incidental Mutation 'R8856:Ubr1'
ID675302
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R8856 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120904042 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1126 (S1126T)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect probably damaging
Transcript: ENSMUST00000028728
AA Change: S1126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: S1126T

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G A 6: 121,641,390 R214H probably benign Het
Abca4 A G 3: 122,112,447 S822G probably benign Het
Adgrv1 T A 13: 81,559,502 I1262F probably benign Het
Agbl2 A G 2: 90,801,744 D482G probably damaging Het
Asph T A 4: 9,630,947 T134S possibly damaging Het
Cacna1a C T 8: 84,559,441 A905V probably benign Het
Cacna1b C T 2: 24,679,518 R798H probably benign Het
Cpne8 G T 15: 90,601,841 Q140K probably benign Het
Crocc2 A T 1: 93,193,125 N538I probably benign Het
Cyp2j9 T A 4: 96,573,947 I366F probably damaging Het
Dchs1 A T 7: 105,760,857 D1769E probably damaging Het
Def6 A T 17: 28,216,998 I44F probably damaging Het
Dnah7a G A 1: 53,423,263 T3723M probably damaging Het
Ecd T A 14: 20,337,072 Y198F probably damaging Het
Ecel1 A C 1: 87,152,038 M451R probably damaging Het
Eea1 A G 10: 95,995,644 D199G probably benign Het
Efna5 A T 17: 62,607,379 I217N unknown Het
F13a1 A T 13: 36,916,885 D428E probably damaging Het
Fads1 T G 19: 10,192,912 I272S probably benign Het
Fam149a C T 8: 45,381,574 A63T Het
Fam83a A T 15: 58,009,581 N269Y probably damaging Het
Fasn G A 11: 120,818,153 T568I possibly damaging Het
Fbn1 A G 2: 125,314,717 S2363P probably damaging Het
Fbxl4 T A 4: 22,390,803 W329R probably damaging Het
Fgf12 A T 16: 28,189,481 V189E probably damaging Het
Frmd4b A T 6: 97,292,398 Y984* probably null Het
Galm A G 17: 80,183,232 T273A possibly damaging Het
Gm13078 A T 4: 143,726,733 N137I probably benign Het
Gm43302 A G 5: 105,290,873 S50P probably damaging Het
Gm45861 C T 8: 27,520,760 S561L unknown Het
Gm9573 T C 17: 35,620,973 T774A unknown Het
Gnao1 A G 8: 93,811,417 I28V probably benign Het
Golga4 A G 9: 118,556,711 N967S probably damaging Het
Gpr155 A T 2: 73,373,649 F274I probably benign Het
Grm1 A C 10: 10,719,348 N845K probably damaging Het
Hnrnpa2b1 A T 6: 51,466,140 probably null Het
Hsf4 G T 8: 105,269,996 D18Y probably null Het
Htt T A 5: 34,903,331 D2774E probably benign Het
Iars2 A G 1: 185,296,424 I679T probably benign Het
Irf4 T C 13: 30,761,431 F387L probably damaging Het
Itgb5 A G 16: 33,900,592 Y342C probably damaging Het
Kcnmb4 A G 10: 116,446,394 W133R possibly damaging Het
Ldhc A T 7: 46,876,575 H271L probably benign Het
Lmtk2 C A 5: 144,176,261 D1266E probably damaging Het
Lrrtm1 C A 6: 77,244,824 N421K possibly damaging Het
Ly9 G A 1: 171,605,019 T142I probably benign Het
Manba A G 3: 135,518,003 Y217C probably damaging Het
Mapkbp1 T C 2: 120,014,628 L330P probably damaging Het
March2 A T 17: 33,696,191 V143E probably benign Het
Mmel1 A T 4: 154,885,021 D191V possibly damaging Het
Mrgpra1 A T 7: 47,335,835 I32N probably benign Het
Mroh2b C T 15: 4,931,028 Q748* probably null Het
Mrpl34 T G 8: 71,465,380 W66G probably damaging Het
Nde1 T A 16: 14,183,582 S165T Het
Nek10 T G 14: 14,937,610 I776M probably damaging Het
Nell2 A G 15: 95,383,671 S385P probably damaging Het
Nsf A T 11: 103,930,742 F29Y possibly damaging Het
Nsmaf A T 4: 6,433,320 Y133* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr761 A T 17: 37,952,200 S275T possibly damaging Het
Pcdhb8 A G 18: 37,356,723 I485V probably benign Het
Poteg T A 8: 27,448,005 M1K probably null Het
Prdm5 G A 6: 65,883,585 V418I possibly damaging Het
Psmc6 T A 14: 45,340,863 C228S probably damaging Het
Ptgfrn C T 3: 101,056,611 A562T possibly damaging Het
Ralgapa2 G T 2: 146,342,219 Q1576K probably benign Het
Ranbp9 C T 13: 43,414,030 G400D probably damaging Het
Rgs11 A T 17: 26,204,510 I134F probably damaging Het
Rnf150 T A 8: 83,036,086 C317S probably damaging Het
Rrm2b G A 15: 37,960,614 probably benign Het
Scai T C 2: 39,106,966 Q272R probably benign Het
Sec62 C T 3: 30,793,357 R4C possibly damaging Het
Sgo2b C A 8: 63,940,057 L115F probably null Het
Slc44a3 G A 3: 121,513,807 P177S probably damaging Het
Slc45a4 G A 15: 73,586,117 L528F probably damaging Het
Slco1a1 G T 6: 141,911,898 A569D probably damaging Het
Stam2 G T 2: 52,714,972 Q184K probably damaging Het
Tada2b A T 5: 36,483,822 L79Q probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tecta A T 9: 42,373,301 D829E probably benign Het
Tepsin A G 11: 120,091,828 V472A probably benign Het
Tnfrsf1a G A 6: 125,357,725 M109I possibly damaging Het
Trim42 A T 9: 97,363,222 Y508* probably null Het
Trmo T G 4: 46,387,625 N65T probably benign Het
Tspear G T 10: 77,829,637 E86* probably null Het
Usp50 C A 2: 126,780,557 D28Y probably damaging Het
Utp6 T A 11: 79,951,629 I225F probably benign Het
Utrn T C 10: 12,667,607 T1766A probably benign Het
Vcl T A 14: 20,995,092 N288K probably benign Het
Vmn2r69 T C 7: 85,412,455 N104D probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfhx4 T A 3: 5,390,424 S1159R probably benign Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 splice site probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 splice site probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120934374 missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120934417 nonsense probably null
R8221:Ubr1 UTSW 2 120961104 missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120963456 missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120911115 missense probably benign
R8293:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R8420:Ubr1 UTSW 2 120870995 missense probably benign
R8489:Ubr1 UTSW 2 120881067 missense probably benign 0.42
R8708:Ubr1 UTSW 2 120866483 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ACAGTCAAGAGGTTGATGTGAC -3'
(R):5'- GTTGTTTCTTTTGATAGCACCTCAG -3'

Sequencing Primer
(F):5'- AGGTTGATGTGACATGTTAAGAGCC -3'
(R):5'- TTGATAGCACCTCAGCAGTCAGTG -3'
Posted On2021-07-15