Incidental Mutation 'R8856:Sec62'
ID 675308
Institutional Source Beutler Lab
Gene Symbol Sec62
Ensembl Gene ENSMUSG00000027706
Gene Name SEC62 homolog (S. cerevisiae)
Synonyms 3100002M17Rik, Dtrp1, Tloc1, HTP1, SEC62
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock # R8856 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 30792875-30821263 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30793357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 4 (R4C)
Ref Sequence ENSEMBL: ENSMUSP00000029256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029256]
AlphaFold Q8BU14
Predicted Effect possibly damaging
Transcript: ENSMUST00000029256
AA Change: R4C

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029256
Gene: ENSMUSG00000027706
AA Change: R4C

DomainStartEndE-ValueType
Pfam:Sec62 87 311 1.1e-78 PFAM
low complexity region 338 357 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC63 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G A 6: 121,641,390 R214H probably benign Het
Abca4 A G 3: 122,112,447 S822G probably benign Het
Adgrv1 T A 13: 81,559,502 I1262F probably benign Het
Agbl2 A G 2: 90,801,744 D482G probably damaging Het
Asph T A 4: 9,630,947 T134S possibly damaging Het
Cacna1a C T 8: 84,559,441 A905V probably benign Het
Cacna1b C T 2: 24,679,518 R798H probably benign Het
Cpne8 G T 15: 90,601,841 Q140K probably benign Het
Crocc2 A T 1: 93,193,125 N538I probably benign Het
Cyp2j9 T A 4: 96,573,947 I366F probably damaging Het
Dchs1 A T 7: 105,760,857 D1769E probably damaging Het
Def6 A T 17: 28,216,998 I44F probably damaging Het
Dnah7a G A 1: 53,423,263 T3723M probably damaging Het
Ecd T A 14: 20,337,072 Y198F probably damaging Het
Ecel1 A C 1: 87,152,038 M451R probably damaging Het
Eea1 A G 10: 95,995,644 D199G probably benign Het
Efna5 A T 17: 62,607,379 I217N unknown Het
F13a1 A T 13: 36,916,885 D428E probably damaging Het
Fads1 T G 19: 10,192,912 I272S probably benign Het
Fam149a C T 8: 45,381,574 A63T Het
Fam83a A T 15: 58,009,581 N269Y probably damaging Het
Fasn G A 11: 120,818,153 T568I possibly damaging Het
Fbn1 A G 2: 125,314,717 S2363P probably damaging Het
Fbxl4 T A 4: 22,390,803 W329R probably damaging Het
Fgf12 A T 16: 28,189,481 V189E probably damaging Het
Frmd4b A T 6: 97,292,398 Y984* probably null Het
Galm A G 17: 80,183,232 T273A possibly damaging Het
Gm13078 A T 4: 143,726,733 N137I probably benign Het
Gm43302 A G 5: 105,290,873 S50P probably damaging Het
Gm45861 C T 8: 27,520,760 S561L unknown Het
Gm9573 T C 17: 35,620,973 T774A unknown Het
Gnao1 A G 8: 93,811,417 I28V probably benign Het
Golga4 A G 9: 118,556,711 N967S probably damaging Het
Gpr155 A T 2: 73,373,649 F274I probably benign Het
Grm1 A C 10: 10,719,348 N845K probably damaging Het
Hnrnpa2b1 A T 6: 51,466,140 probably null Het
Hsf4 G T 8: 105,269,996 D18Y probably null Het
Htt T A 5: 34,903,331 D2774E probably benign Het
Iars2 A G 1: 185,296,424 I679T probably benign Het
Irf4 T C 13: 30,761,431 F387L probably damaging Het
Itgb5 A G 16: 33,900,592 Y342C probably damaging Het
Kcnmb4 A G 10: 116,446,394 W133R possibly damaging Het
Ldhc A T 7: 46,876,575 H271L probably benign Het
Lmtk2 C A 5: 144,176,261 D1266E probably damaging Het
Lrrtm1 C A 6: 77,244,824 N421K possibly damaging Het
Ly9 G A 1: 171,605,019 T142I probably benign Het
Manba A G 3: 135,518,003 Y217C probably damaging Het
Mapkbp1 T C 2: 120,014,628 L330P probably damaging Het
March2 A T 17: 33,696,191 V143E probably benign Het
Mmel1 A T 4: 154,885,021 D191V possibly damaging Het
Mrgpra1 A T 7: 47,335,835 I32N probably benign Het
Mroh2b C T 15: 4,931,028 Q748* probably null Het
Mrpl34 T G 8: 71,465,380 W66G probably damaging Het
Nde1 T A 16: 14,183,582 S165T Het
Nek10 T G 14: 14,937,610 I776M probably damaging Het
Nell2 A G 15: 95,383,671 S385P probably damaging Het
Nsf A T 11: 103,930,742 F29Y possibly damaging Het
Nsmaf A T 4: 6,433,320 Y133* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr761 A T 17: 37,952,200 S275T possibly damaging Het
Pcdhb8 A G 18: 37,356,723 I485V probably benign Het
Poteg T A 8: 27,448,005 M1K probably null Het
Prdm5 G A 6: 65,883,585 V418I possibly damaging Het
Psmc6 T A 14: 45,340,863 C228S probably damaging Het
Ptgfrn C T 3: 101,056,611 A562T possibly damaging Het
Ralgapa2 G T 2: 146,342,219 Q1576K probably benign Het
Ranbp9 C T 13: 43,414,030 G400D probably damaging Het
Rgs11 A T 17: 26,204,510 I134F probably damaging Het
Rnf150 T A 8: 83,036,086 C317S probably damaging Het
Rrm2b G A 15: 37,960,614 probably benign Het
Scai T C 2: 39,106,966 Q272R probably benign Het
Sgo2b C A 8: 63,940,057 L115F probably null Het
Slc44a3 G A 3: 121,513,807 P177S probably damaging Het
Slc45a4 G A 15: 73,586,117 L528F probably damaging Het
Slco1a1 G T 6: 141,911,898 A569D probably damaging Het
Stam2 G T 2: 52,714,972 Q184K probably damaging Het
Tada2b A T 5: 36,483,822 L79Q probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tecta A T 9: 42,373,301 D829E probably benign Het
Tepsin A G 11: 120,091,828 V472A probably benign Het
Tnfrsf1a G A 6: 125,357,725 M109I possibly damaging Het
Trim42 A T 9: 97,363,222 Y508* probably null Het
Trmo T G 4: 46,387,625 N65T probably benign Het
Tspear G T 10: 77,829,637 E86* probably null Het
Ubr1 A T 2: 120,904,042 S1126T probably damaging Het
Usp50 C A 2: 126,780,557 D28Y probably damaging Het
Utp6 T A 11: 79,951,629 I225F probably benign Het
Utrn T C 10: 12,667,607 T1766A probably benign Het
Vcl T A 14: 20,995,092 N288K probably benign Het
Vmn2r69 T C 7: 85,412,455 N104D probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfhx4 T A 3: 5,390,424 S1159R probably benign Het
Other mutations in Sec62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sec62 APN 3 30810442 splice site probably benign
IGL01359:Sec62 APN 3 30814306 missense unknown
IGL01746:Sec62 APN 3 30814246 missense probably benign 0.39
IGL02437:Sec62 APN 3 30818847 missense unknown
IGL03355:Sec62 APN 3 30809922 missense unknown
R2400:Sec62 UTSW 3 30810532 missense unknown
R4423:Sec62 UTSW 3 30814282 missense unknown
R4649:Sec62 UTSW 3 30810534 missense unknown
R4717:Sec62 UTSW 3 30809871 missense unknown
R4837:Sec62 UTSW 3 30809869 missense unknown
R5775:Sec62 UTSW 3 30793287 utr 5 prime probably benign
R6153:Sec62 UTSW 3 30810482 missense unknown
R6275:Sec62 UTSW 3 30809836 missense probably damaging 0.98
R6734:Sec62 UTSW 3 30810460 missense probably benign 0.39
R7216:Sec62 UTSW 3 30818829 nonsense probably null
R7250:Sec62 UTSW 3 30812347 missense possibly damaging 0.57
R7453:Sec62 UTSW 3 30809796 splice site probably null
R8411:Sec62 UTSW 3 30818782 missense unknown
R8537:Sec62 UTSW 3 30818812 missense unknown
R8769:Sec62 UTSW 3 30810028 critical splice donor site probably null
R8907:Sec62 UTSW 3 30810472 missense unknown
R8957:Sec62 UTSW 3 30810522 missense unknown
R8969:Sec62 UTSW 3 30818875 missense unknown
R9089:Sec62 UTSW 3 30814234 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AACTTGGCGGGACTGAAGTG -3'
(R):5'- CGTGGCCTTAATATCGGGAC -3'

Sequencing Primer
(F):5'- TGTTTACACGCCAGCCAG -3'
(R):5'- GCACCACAGAGCCCTCG -3'
Posted On 2021-07-15