Incidental Mutation 'R0731:Gigyf2'
ID 67531
Institutional Source Beutler Lab
Gene Symbol Gigyf2
Ensembl Gene ENSMUSG00000048000
Gene Name GRB10 interacting GYF protein 2
Synonyms 2610016F01Rik, Tnrc15, A830080H02Rik
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R0731 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 87254720-87378518 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 87335449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027475] [ENSMUST00000164992] [ENSMUST00000172736] [ENSMUST00000172794] [ENSMUST00000172964] [ENSMUST00000173148] [ENSMUST00000173152] [ENSMUST00000173173] [ENSMUST00000174501] [ENSMUST00000173663] [ENSMUST00000174334]
AlphaFold Q6Y7W8
Predicted Effect probably benign
Transcript: ENSMUST00000027475
SMART Domains Protein: ENSMUSP00000027475
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164992
SMART Domains Protein: ENSMUSP00000129046
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
low complexity region 190 228 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
GYF 478 533 2.83e-26 SMART
low complexity region 563 610 N/A INTRINSIC
coiled coil region 666 721 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172736
SMART Domains Protein: ENSMUSP00000134620
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 49 87 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172794
SMART Domains Protein: ENSMUSP00000134077
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
internal_repeat_1 338 378 2.29e-5 PROSPERO
internal_repeat_1 398 434 2.29e-5 PROSPERO
GYF 529 584 2.83e-26 SMART
low complexity region 614 661 N/A INTRINSIC
coiled coil region 717 1031 N/A INTRINSIC
low complexity region 1090 1104 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
coiled coil region 1188 1217 N/A INTRINSIC
low complexity region 1230 1240 N/A INTRINSIC
low complexity region 1248 1254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172964
SMART Domains Protein: ENSMUSP00000133392
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 3.03e-5 PROSPERO
internal_repeat_1 404 440 3.03e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
SCOP:d1eq1a_ 724 859 1e-2 SMART
low complexity region 953 972 N/A INTRINSIC
low complexity region 1008 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173148
Predicted Effect probably benign
Transcript: ENSMUST00000173152
SMART Domains Protein: ENSMUSP00000134086
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 28 66 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173173
SMART Domains Protein: ENSMUSP00000134193
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
GYF 528 583 2.83e-26 SMART
low complexity region 613 660 N/A INTRINSIC
SCOP:d1eq1a_ 717 852 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173235
SMART Domains Protein: ENSMUSP00000134677
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 69 107 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
internal_repeat_1 166 206 3.2e-5 PROSPERO
internal_repeat_1 226 262 3.2e-5 PROSPERO
GYF 357 412 2.83e-26 SMART
low complexity region 442 489 N/A INTRINSIC
coiled coil region 544 745 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173636
Predicted Effect probably benign
Transcript: ENSMUST00000174501
SMART Domains Protein: ENSMUSP00000133327
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174535
Predicted Effect probably benign
Transcript: ENSMUST00000173663
SMART Domains Protein: ENSMUSP00000133416
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 22 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174334
SMART Domains Protein: ENSMUSP00000133666
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 77 84 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains CAG trinucleotide repeats and encodes a protein containing several stretches of polyglutamine residues. The encoded protein may be involved in the regulation of tyrosine kinase receptor signaling. This gene is located in a chromosomal region that was genetically linked to Parkinson disease type 11, and mutations in this gene were thought to be causative for this disease. However, more recent studies in different populations have been unable to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal and postnatal lethality. Mice heterozygous for a knock-out allele exhibit impaired motor coordination with motor neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Gigyf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gigyf2 APN 1 87,364,572 (GRCm39) missense probably damaging 0.99
IGL01828:Gigyf2 APN 1 87,346,820 (GRCm39) missense probably damaging 1.00
IGL02222:Gigyf2 APN 1 87,338,585 (GRCm39) splice site probably null
IGL02259:Gigyf2 APN 1 87,339,559 (GRCm39) missense probably damaging 1.00
IGL02562:Gigyf2 APN 1 87,335,097 (GRCm39) missense probably benign 0.15
IGL02565:Gigyf2 APN 1 87,369,858 (GRCm39) missense probably damaging 1.00
IGL02695:Gigyf2 APN 1 87,344,549 (GRCm39) missense probably benign 0.07
IGL03264:Gigyf2 APN 1 87,376,790 (GRCm39) splice site probably benign
Flop UTSW 1 87,292,988 (GRCm39) missense probably damaging 1.00
FR4449:Gigyf2 UTSW 1 87,356,307 (GRCm39) unclassified probably benign
PIT4260001:Gigyf2 UTSW 1 87,346,828 (GRCm39) missense unknown
R0041:Gigyf2 UTSW 1 87,306,698 (GRCm39) missense probably damaging 1.00
R0126:Gigyf2 UTSW 1 87,339,597 (GRCm39) splice site probably benign
R0190:Gigyf2 UTSW 1 87,356,410 (GRCm39) unclassified probably benign
R0244:Gigyf2 UTSW 1 87,306,737 (GRCm39) missense possibly damaging 0.96
R0492:Gigyf2 UTSW 1 87,368,568 (GRCm39) missense probably damaging 1.00
R0526:Gigyf2 UTSW 1 87,349,215 (GRCm39) missense probably benign 0.00
R0612:Gigyf2 UTSW 1 87,376,802 (GRCm39) missense probably damaging 1.00
R0783:Gigyf2 UTSW 1 87,334,883 (GRCm39) missense probably damaging 0.99
R1445:Gigyf2 UTSW 1 87,371,360 (GRCm39) splice site probably benign
R1620:Gigyf2 UTSW 1 87,376,850 (GRCm39) missense probably damaging 1.00
R1678:Gigyf2 UTSW 1 87,344,705 (GRCm39) missense probably benign 0.44
R2008:Gigyf2 UTSW 1 87,301,835 (GRCm39) critical splice donor site probably null
R2111:Gigyf2 UTSW 1 87,368,452 (GRCm39) missense probably damaging 0.99
R2112:Gigyf2 UTSW 1 87,368,452 (GRCm39) missense probably damaging 0.99
R2180:Gigyf2 UTSW 1 87,344,642 (GRCm39) missense probably damaging 1.00
R3438:Gigyf2 UTSW 1 87,368,302 (GRCm39) missense probably damaging 0.96
R3690:Gigyf2 UTSW 1 87,349,238 (GRCm39) missense possibly damaging 0.80
R4089:Gigyf2 UTSW 1 87,371,394 (GRCm39) missense probably damaging 1.00
R4411:Gigyf2 UTSW 1 87,364,582 (GRCm39) missense probably damaging 1.00
R4412:Gigyf2 UTSW 1 87,364,582 (GRCm39) missense probably damaging 1.00
R4489:Gigyf2 UTSW 1 87,368,548 (GRCm39) missense probably damaging 1.00
R4743:Gigyf2 UTSW 1 87,292,970 (GRCm39) nonsense probably null
R4769:Gigyf2 UTSW 1 87,368,571 (GRCm39) missense probably damaging 1.00
R4854:Gigyf2 UTSW 1 87,282,135 (GRCm39) unclassified probably benign
R5215:Gigyf2 UTSW 1 87,292,988 (GRCm39) missense probably damaging 1.00
R5326:Gigyf2 UTSW 1 87,352,860 (GRCm39) unclassified probably benign
R5771:Gigyf2 UTSW 1 87,374,050 (GRCm39) missense possibly damaging 0.90
R5813:Gigyf2 UTSW 1 87,368,485 (GRCm39) missense probably damaging 0.99
R5964:Gigyf2 UTSW 1 87,334,889 (GRCm39) missense probably damaging 1.00
R6026:Gigyf2 UTSW 1 87,368,454 (GRCm39) missense probably damaging 0.99
R6035:Gigyf2 UTSW 1 87,338,450 (GRCm39) missense possibly damaging 0.93
R6035:Gigyf2 UTSW 1 87,338,450 (GRCm39) missense possibly damaging 0.93
R6784:Gigyf2 UTSW 1 87,371,396 (GRCm39) missense probably damaging 1.00
R6800:Gigyf2 UTSW 1 87,346,898 (GRCm39) missense possibly damaging 0.68
R6991:Gigyf2 UTSW 1 87,334,858 (GRCm39) missense probably damaging 1.00
R7224:Gigyf2 UTSW 1 87,331,447 (GRCm39) missense unknown
R7464:Gigyf2 UTSW 1 87,356,326 (GRCm39) missense unknown
R7554:Gigyf2 UTSW 1 87,335,292 (GRCm39) missense unknown
R7658:Gigyf2 UTSW 1 87,346,860 (GRCm39) missense unknown
R7976:Gigyf2 UTSW 1 87,331,458 (GRCm39) missense unknown
R8032:Gigyf2 UTSW 1 87,334,735 (GRCm39) missense unknown
R8070:Gigyf2 UTSW 1 87,368,629 (GRCm39) missense probably benign 0.03
R8071:Gigyf2 UTSW 1 87,374,155 (GRCm39) missense probably damaging 0.99
R8519:Gigyf2 UTSW 1 87,338,431 (GRCm39) missense probably benign 0.01
R8675:Gigyf2 UTSW 1 87,331,438 (GRCm39) missense unknown
R8849:Gigyf2 UTSW 1 87,361,592 (GRCm39) missense unknown
R8872:Gigyf2 UTSW 1 87,307,725 (GRCm39) missense unknown
R9184:Gigyf2 UTSW 1 87,368,311 (GRCm39) missense possibly damaging 0.95
R9465:Gigyf2 UTSW 1 87,334,775 (GRCm39) missense unknown
R9502:Gigyf2 UTSW 1 87,331,446 (GRCm39) missense unknown
R9616:Gigyf2 UTSW 1 87,356,326 (GRCm39) missense unknown
R9665:Gigyf2 UTSW 1 87,331,457 (GRCm39) missense unknown
X0065:Gigyf2 UTSW 1 87,339,589 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGACTCTGACAGCAGCCATAAC -3'
(R):5'- AGTGCAGTCGAGACAGCTCTAGTG -3'

Sequencing Primer
(F):5'- TGATTACTTTGTGTTCCAGAAGC -3'
(R):5'- GAGACAGCTCTAGTGCCTTAG -3'
Posted On 2013-09-03