Incidental Mutation 'R8856:Slc44a3'
ID 675310
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Name solute carrier family 44, member 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8856 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 121459528-121532404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 121513807 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 177 (P177S)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
AlphaFold Q921V7
Predicted Effect probably damaging
Transcript: ENSMUST00000039197
AA Change: P177S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: P177S

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G A 6: 121,641,390 R214H probably benign Het
Abca4 A G 3: 122,112,447 S822G probably benign Het
Adgrv1 T A 13: 81,559,502 I1262F probably benign Het
Agbl2 A G 2: 90,801,744 D482G probably damaging Het
Asph T A 4: 9,630,947 T134S possibly damaging Het
Cacna1a C T 8: 84,559,441 A905V probably benign Het
Cacna1b C T 2: 24,679,518 R798H probably benign Het
Cpne8 G T 15: 90,601,841 Q140K probably benign Het
Crocc2 A T 1: 93,193,125 N538I probably benign Het
Cyp2j9 T A 4: 96,573,947 I366F probably damaging Het
Dchs1 A T 7: 105,760,857 D1769E probably damaging Het
Def6 A T 17: 28,216,998 I44F probably damaging Het
Dnah7a G A 1: 53,423,263 T3723M probably damaging Het
Ecd T A 14: 20,337,072 Y198F probably damaging Het
Ecel1 A C 1: 87,152,038 M451R probably damaging Het
Eea1 A G 10: 95,995,644 D199G probably benign Het
Efna5 A T 17: 62,607,379 I217N unknown Het
F13a1 A T 13: 36,916,885 D428E probably damaging Het
Fads1 T G 19: 10,192,912 I272S probably benign Het
Fam149a C T 8: 45,381,574 A63T Het
Fam83a A T 15: 58,009,581 N269Y probably damaging Het
Fasn G A 11: 120,818,153 T568I possibly damaging Het
Fbn1 A G 2: 125,314,717 S2363P probably damaging Het
Fbxl4 T A 4: 22,390,803 W329R probably damaging Het
Fgf12 A T 16: 28,189,481 V189E probably damaging Het
Frmd4b A T 6: 97,292,398 Y984* probably null Het
Galm A G 17: 80,183,232 T273A possibly damaging Het
Gm13078 A T 4: 143,726,733 N137I probably benign Het
Gm43302 A G 5: 105,290,873 S50P probably damaging Het
Gm45861 C T 8: 27,520,760 S561L unknown Het
Gm9573 T C 17: 35,620,973 T774A unknown Het
Gnao1 A G 8: 93,811,417 I28V probably benign Het
Golga4 A G 9: 118,556,711 N967S probably damaging Het
Gpr155 A T 2: 73,373,649 F274I probably benign Het
Grm1 A C 10: 10,719,348 N845K probably damaging Het
Hnrnpa2b1 A T 6: 51,466,140 probably null Het
Hsf4 G T 8: 105,269,996 D18Y probably null Het
Htt T A 5: 34,903,331 D2774E probably benign Het
Iars2 A G 1: 185,296,424 I679T probably benign Het
Irf4 T C 13: 30,761,431 F387L probably damaging Het
Itgb5 A G 16: 33,900,592 Y342C probably damaging Het
Kcnmb4 A G 10: 116,446,394 W133R possibly damaging Het
Ldhc A T 7: 46,876,575 H271L probably benign Het
Lmtk2 C A 5: 144,176,261 D1266E probably damaging Het
Lrrtm1 C A 6: 77,244,824 N421K possibly damaging Het
Ly9 G A 1: 171,605,019 T142I probably benign Het
Manba A G 3: 135,518,003 Y217C probably damaging Het
Mapkbp1 T C 2: 120,014,628 L330P probably damaging Het
March2 A T 17: 33,696,191 V143E probably benign Het
Mmel1 A T 4: 154,885,021 D191V possibly damaging Het
Mrgpra1 A T 7: 47,335,835 I32N probably benign Het
Mroh2b C T 15: 4,931,028 Q748* probably null Het
Mrpl34 T G 8: 71,465,380 W66G probably damaging Het
Nde1 T A 16: 14,183,582 S165T Het
Nek10 T G 14: 14,937,610 I776M probably damaging Het
Nell2 A G 15: 95,383,671 S385P probably damaging Het
Nsf A T 11: 103,930,742 F29Y possibly damaging Het
Nsmaf A T 4: 6,433,320 Y133* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr761 A T 17: 37,952,200 S275T possibly damaging Het
Pcdhb8 A G 18: 37,356,723 I485V probably benign Het
Poteg T A 8: 27,448,005 M1K probably null Het
Prdm5 G A 6: 65,883,585 V418I possibly damaging Het
Psmc6 T A 14: 45,340,863 C228S probably damaging Het
Ptgfrn C T 3: 101,056,611 A562T possibly damaging Het
Ralgapa2 G T 2: 146,342,219 Q1576K probably benign Het
Ranbp9 C T 13: 43,414,030 G400D probably damaging Het
Rgs11 A T 17: 26,204,510 I134F probably damaging Het
Rnf150 T A 8: 83,036,086 C317S probably damaging Het
Rrm2b G A 15: 37,960,614 probably benign Het
Scai T C 2: 39,106,966 Q272R probably benign Het
Sec62 C T 3: 30,793,357 R4C possibly damaging Het
Sgo2b C A 8: 63,940,057 L115F probably null Het
Slc45a4 G A 15: 73,586,117 L528F probably damaging Het
Slco1a1 G T 6: 141,911,898 A569D probably damaging Het
Stam2 G T 2: 52,714,972 Q184K probably damaging Het
Tada2b A T 5: 36,483,822 L79Q probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tecta A T 9: 42,373,301 D829E probably benign Het
Tepsin A G 11: 120,091,828 V472A probably benign Het
Tnfrsf1a G A 6: 125,357,725 M109I possibly damaging Het
Trim42 A T 9: 97,363,222 Y508* probably null Het
Trmo T G 4: 46,387,625 N65T probably benign Het
Tspear G T 10: 77,829,637 E86* probably null Het
Ubr1 A T 2: 120,904,042 S1126T probably damaging Het
Usp50 C A 2: 126,780,557 D28Y probably damaging Het
Utp6 T A 11: 79,951,629 I225F probably benign Het
Utrn T C 10: 12,667,607 T1766A probably benign Het
Vcl T A 14: 20,995,092 N288K probably benign Het
Vmn2r69 T C 7: 85,412,455 N104D probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfhx4 T A 3: 5,390,424 S1159R probably benign Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
BB009:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
BB019:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
R7932:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R8104:Slc44a3 UTSW 3 121497872 missense probably benign 0.01
R8529:Slc44a3 UTSW 3 121525685 missense probably benign 0.36
R8679:Slc44a3 UTSW 3 121490269 missense probably damaging 1.00
R9053:Slc44a3 UTSW 3 121527190 missense probably damaging 1.00
R9121:Slc44a3 UTSW 3 121461137 missense probably benign 0.00
R9360:Slc44a3 UTSW 3 121532259 start gained probably benign
Z1176:Slc44a3 UTSW 3 121532251 start gained probably benign
Z1177:Slc44a3 UTSW 3 121497750 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GAGTGCTGGGAAATTCACCATTC -3'
(R):5'- GCATCCTGATTGTCTTTAGAGCC -3'

Sequencing Primer
(F):5'- GTGCTGGGAAATTCACCATTCCATAC -3'
(R):5'- GAGCCAAGTAAGCGTCTTTACCTG -3'
Posted On 2021-07-15