Incidental Mutation 'R8856:Tecpr1'
ID675324
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8856 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144216299 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085701
AA Change: E204G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: E204G

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G A 6: 121,641,390 R214H probably benign Het
Abca4 A G 3: 122,112,447 S822G probably benign Het
Adgrv1 T A 13: 81,559,502 I1262F probably benign Het
Agbl2 A G 2: 90,801,744 D482G probably damaging Het
Asph T A 4: 9,630,947 T134S possibly damaging Het
Cacna1a C T 8: 84,559,441 A905V probably benign Het
Cacna1b C T 2: 24,679,518 R798H probably benign Het
Cpne8 G T 15: 90,601,841 Q140K probably benign Het
Crocc2 A T 1: 93,193,125 N538I probably benign Het
Cyp2j9 T A 4: 96,573,947 I366F probably damaging Het
Dchs1 A T 7: 105,760,857 D1769E probably damaging Het
Def6 A T 17: 28,216,998 I44F probably damaging Het
Dnah7a G A 1: 53,423,263 T3723M probably damaging Het
Ecd T A 14: 20,337,072 Y198F probably damaging Het
Ecel1 A C 1: 87,152,038 M451R probably damaging Het
Eea1 A G 10: 95,995,644 D199G probably benign Het
Efna5 A T 17: 62,607,379 I217N unknown Het
F13a1 A T 13: 36,916,885 D428E probably damaging Het
Fads1 T G 19: 10,192,912 I272S probably benign Het
Fam149a C T 8: 45,381,574 A63T Het
Fam83a A T 15: 58,009,581 N269Y probably damaging Het
Fasn G A 11: 120,818,153 T568I possibly damaging Het
Fbn1 A G 2: 125,314,717 S2363P probably damaging Het
Fbxl4 T A 4: 22,390,803 W329R probably damaging Het
Fgf12 A T 16: 28,189,481 V189E probably damaging Het
Frmd4b A T 6: 97,292,398 Y984* probably null Het
Galm A G 17: 80,183,232 T273A possibly damaging Het
Gm13078 A T 4: 143,726,733 N137I probably benign Het
Gm43302 A G 5: 105,290,873 S50P probably damaging Het
Gm45861 C T 8: 27,520,760 S561L unknown Het
Gm9573 T C 17: 35,620,973 T774A unknown Het
Gnao1 A G 8: 93,811,417 I28V probably benign Het
Golga4 A G 9: 118,556,711 N967S probably damaging Het
Gpr155 A T 2: 73,373,649 F274I probably benign Het
Grm1 A C 10: 10,719,348 N845K probably damaging Het
Hnrnpa2b1 A T 6: 51,466,140 probably null Het
Hsf4 G T 8: 105,269,996 D18Y probably null Het
Htt T A 5: 34,903,331 D2774E probably benign Het
Iars2 A G 1: 185,296,424 I679T probably benign Het
Irf4 T C 13: 30,761,431 F387L probably damaging Het
Itgb5 A G 16: 33,900,592 Y342C probably damaging Het
Kcnmb4 A G 10: 116,446,394 W133R possibly damaging Het
Ldhc A T 7: 46,876,575 H271L probably benign Het
Lmtk2 C A 5: 144,176,261 D1266E probably damaging Het
Lrrtm1 C A 6: 77,244,824 N421K possibly damaging Het
Ly9 G A 1: 171,605,019 T142I probably benign Het
Manba A G 3: 135,518,003 Y217C probably damaging Het
Mapkbp1 T C 2: 120,014,628 L330P probably damaging Het
March2 A T 17: 33,696,191 V143E probably benign Het
Mmel1 A T 4: 154,885,021 D191V possibly damaging Het
Mrgpra1 A T 7: 47,335,835 I32N probably benign Het
Mroh2b C T 15: 4,931,028 Q748* probably null Het
Mrpl34 T G 8: 71,465,380 W66G probably damaging Het
Nde1 T A 16: 14,183,582 S165T Het
Nek10 T G 14: 14,937,610 I776M probably damaging Het
Nell2 A G 15: 95,383,671 S385P probably damaging Het
Nsf A T 11: 103,930,742 F29Y possibly damaging Het
Nsmaf A T 4: 6,433,320 Y133* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr761 A T 17: 37,952,200 S275T possibly damaging Het
Pcdhb8 A G 18: 37,356,723 I485V probably benign Het
Poteg T A 8: 27,448,005 M1K probably null Het
Prdm5 G A 6: 65,883,585 V418I possibly damaging Het
Psmc6 T A 14: 45,340,863 C228S probably damaging Het
Ptgfrn C T 3: 101,056,611 A562T possibly damaging Het
Ralgapa2 G T 2: 146,342,219 Q1576K probably benign Het
Ranbp9 C T 13: 43,414,030 G400D probably damaging Het
Rgs11 A T 17: 26,204,510 I134F probably damaging Het
Rnf150 T A 8: 83,036,086 C317S probably damaging Het
Rrm2b G A 15: 37,960,614 probably benign Het
Scai T C 2: 39,106,966 Q272R probably benign Het
Sec62 C T 3: 30,793,357 R4C possibly damaging Het
Sgo2b C A 8: 63,940,057 L115F probably null Het
Slc44a3 G A 3: 121,513,807 P177S probably damaging Het
Slc45a4 G A 15: 73,586,117 L528F probably damaging Het
Slco1a1 G T 6: 141,911,898 A569D probably damaging Het
Stam2 G T 2: 52,714,972 Q184K probably damaging Het
Tada2b A T 5: 36,483,822 L79Q probably damaging Het
Tecta A T 9: 42,373,301 D829E probably benign Het
Tepsin A G 11: 120,091,828 V472A probably benign Het
Tnfrsf1a G A 6: 125,357,725 M109I possibly damaging Het
Trim42 A T 9: 97,363,222 Y508* probably null Het
Trmo T G 4: 46,387,625 N65T probably benign Het
Tspear G T 10: 77,829,637 E86* probably null Het
Ubr1 A T 2: 120,904,042 S1126T probably damaging Het
Usp50 C A 2: 126,780,557 D28Y probably damaging Het
Utp6 T A 11: 79,951,629 I225F probably benign Het
Utrn T C 10: 12,667,607 T1766A probably benign Het
Vcl T A 14: 20,995,092 N288K probably benign Het
Vmn2r69 T C 7: 85,412,455 N104D probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfhx4 T A 3: 5,390,424 S1159R probably benign Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8926:Tecpr1 UTSW 5 144216962 missense probably damaging 1.00
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACCATACAAAATCTTGGGCAAG -3'
(R):5'- CTTGCTGAGTGTGGAAGGAC -3'

Sequencing Primer
(F):5'- CTTGGGCAAGATGGTGGTG -3'
(R):5'- CTGAGTGTGGAAGGACTGGAG -3'
Posted On2021-07-15