Incidental Mutation 'R8856:Tnfrsf1a'
ID 675330
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1a
Ensembl Gene ENSMUSG00000030341
Gene Name tumor necrosis factor receptor superfamily, member 1a
Synonyms CD120a, TNFalpha-R1, TNF-R1, p55-R, TNF receptor alpha chain, TNF-R55, TNFRI, TNFRp55, TNFAR, TNFR60, TNF-R-I, Tnfr1, p55, TNF-alpha-R1, TNF-alphaR1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8856 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 125349362-125362484 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 125357725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 109 (M109I)
Ref Sequence ENSEMBL: ENSMUSP00000032491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032491] [ENSMUST00000042647] [ENSMUST00000130257] [ENSMUST00000144524]
AlphaFold P25118
Predicted Effect possibly damaging
Transcript: ENSMUST00000032491
AA Change: M109I

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032491
Gene: ENSMUSG00000030341
AA Change: M109I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 44 81 2.4e-7 SMART
TNFR 84 125 2.19e-10 SMART
TNFR 127 166 5.43e-6 SMART
TNFR 168 195 3.41e1 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
DEATH 345 441 8.04e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042647
SMART Domains Protein: ENSMUSP00000037004
Gene: ENSMUSG00000038167

DomainStartEndE-ValueType
RhoGEF 165 352 1.5e-44 SMART
PH 410 511 8.99e-7 SMART
low complexity region 535 557 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121968
Gene: ENSMUSG00000030341
AA Change: M25I

DomainStartEndE-ValueType
TNFR 2 42 2.09e-7 SMART
TNFR 44 83 5.43e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130257
SMART Domains Protein: ENSMUSP00000115991
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:TNFR_c6 44 66 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144524
SMART Domains Protein: ENSMUSP00000117470
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
TNFR 5 44 5.43e-6 SMART
TNFR 46 73 3.41e1 SMART
transmembrane domain 90 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
Blast:DEATH 223 295 1e-13 BLAST
SCOP:d1icha_ 269 295 3e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mice lacking a functional copy of this gene exhibit impaired immune function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted splenic architecture, increased adult liver weights, reduced IgG immune response, deficits in some host defense and inflammatory responses, LPS resistance, and reduced graft-vs-host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G A 6: 121,641,390 R214H probably benign Het
Abca4 A G 3: 122,112,447 S822G probably benign Het
Adgrv1 T A 13: 81,559,502 I1262F probably benign Het
Agbl2 A G 2: 90,801,744 D482G probably damaging Het
Asph T A 4: 9,630,947 T134S possibly damaging Het
Cacna1a C T 8: 84,559,441 A905V probably benign Het
Cacna1b C T 2: 24,679,518 R798H probably benign Het
Cpne8 G T 15: 90,601,841 Q140K probably benign Het
Crocc2 A T 1: 93,193,125 N538I probably benign Het
Cyp2j9 T A 4: 96,573,947 I366F probably damaging Het
Dchs1 A T 7: 105,760,857 D1769E probably damaging Het
Def6 A T 17: 28,216,998 I44F probably damaging Het
Dnah7a G A 1: 53,423,263 T3723M probably damaging Het
Ecd T A 14: 20,337,072 Y198F probably damaging Het
Ecel1 A C 1: 87,152,038 M451R probably damaging Het
Eea1 A G 10: 95,995,644 D199G probably benign Het
Efna5 A T 17: 62,607,379 I217N unknown Het
F13a1 A T 13: 36,916,885 D428E probably damaging Het
Fads1 T G 19: 10,192,912 I272S probably benign Het
Fam149a C T 8: 45,381,574 A63T Het
Fam83a A T 15: 58,009,581 N269Y probably damaging Het
Fasn G A 11: 120,818,153 T568I possibly damaging Het
Fbn1 A G 2: 125,314,717 S2363P probably damaging Het
Fbxl4 T A 4: 22,390,803 W329R probably damaging Het
Fgf12 A T 16: 28,189,481 V189E probably damaging Het
Frmd4b A T 6: 97,292,398 Y984* probably null Het
Galm A G 17: 80,183,232 T273A possibly damaging Het
Gm13078 A T 4: 143,726,733 N137I probably benign Het
Gm43302 A G 5: 105,290,873 S50P probably damaging Het
Gm45861 C T 8: 27,520,760 S561L unknown Het
Gm9573 T C 17: 35,620,973 T774A unknown Het
Gnao1 A G 8: 93,811,417 I28V probably benign Het
Golga4 A G 9: 118,556,711 N967S probably damaging Het
Gpr155 A T 2: 73,373,649 F274I probably benign Het
Grm1 A C 10: 10,719,348 N845K probably damaging Het
Hnrnpa2b1 A T 6: 51,466,140 probably null Het
Hsf4 G T 8: 105,269,996 D18Y probably null Het
Htt T A 5: 34,903,331 D2774E probably benign Het
Iars2 A G 1: 185,296,424 I679T probably benign Het
Irf4 T C 13: 30,761,431 F387L probably damaging Het
Itgb5 A G 16: 33,900,592 Y342C probably damaging Het
Kcnmb4 A G 10: 116,446,394 W133R possibly damaging Het
Ldhc A T 7: 46,876,575 H271L probably benign Het
Lmtk2 C A 5: 144,176,261 D1266E probably damaging Het
Lrrtm1 C A 6: 77,244,824 N421K possibly damaging Het
Ly9 G A 1: 171,605,019 T142I probably benign Het
Manba A G 3: 135,518,003 Y217C probably damaging Het
Mapkbp1 T C 2: 120,014,628 L330P probably damaging Het
March2 A T 17: 33,696,191 V143E probably benign Het
Mmel1 A T 4: 154,885,021 D191V possibly damaging Het
Mrgpra1 A T 7: 47,335,835 I32N probably benign Het
Mroh2b C T 15: 4,931,028 Q748* probably null Het
Mrpl34 T G 8: 71,465,380 W66G probably damaging Het
Nde1 T A 16: 14,183,582 S165T Het
Nek10 T G 14: 14,937,610 I776M probably damaging Het
Nell2 A G 15: 95,383,671 S385P probably damaging Het
Nsf A T 11: 103,930,742 F29Y possibly damaging Het
Nsmaf A T 4: 6,433,320 Y133* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr761 A T 17: 37,952,200 S275T possibly damaging Het
Pcdhb8 A G 18: 37,356,723 I485V probably benign Het
Poteg T A 8: 27,448,005 M1K probably null Het
Prdm5 G A 6: 65,883,585 V418I possibly damaging Het
Psmc6 T A 14: 45,340,863 C228S probably damaging Het
Ptgfrn C T 3: 101,056,611 A562T possibly damaging Het
Ralgapa2 G T 2: 146,342,219 Q1576K probably benign Het
Ranbp9 C T 13: 43,414,030 G400D probably damaging Het
Rgs11 A T 17: 26,204,510 I134F probably damaging Het
Rnf150 T A 8: 83,036,086 C317S probably damaging Het
Rrm2b G A 15: 37,960,614 probably benign Het
Scai T C 2: 39,106,966 Q272R probably benign Het
Sec62 C T 3: 30,793,357 R4C possibly damaging Het
Sgo2b C A 8: 63,940,057 L115F probably null Het
Slc44a3 G A 3: 121,513,807 P177S probably damaging Het
Slc45a4 G A 15: 73,586,117 L528F probably damaging Het
Slco1a1 G T 6: 141,911,898 A569D probably damaging Het
Stam2 G T 2: 52,714,972 Q184K probably damaging Het
Tada2b A T 5: 36,483,822 L79Q probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tecta A T 9: 42,373,301 D829E probably benign Het
Tepsin A G 11: 120,091,828 V472A probably benign Het
Trim42 A T 9: 97,363,222 Y508* probably null Het
Trmo T G 4: 46,387,625 N65T probably benign Het
Tspear G T 10: 77,829,637 E86* probably null Het
Ubr1 A T 2: 120,904,042 S1126T probably damaging Het
Usp50 C A 2: 126,780,557 D28Y probably damaging Het
Utp6 T A 11: 79,951,629 I225F probably benign Het
Utrn T C 10: 12,667,607 T1766A probably benign Het
Vcl T A 14: 20,995,092 N288K probably benign Het
Vmn2r69 T C 7: 85,412,455 N104D probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfhx4 T A 3: 5,390,424 S1159R probably benign Het
Other mutations in Tnfrsf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Tnfrsf1a APN 6 125356864 missense probably damaging 1.00
IGL02468:Tnfrsf1a APN 6 125357861 missense probably benign 0.06
IGL02588:Tnfrsf1a APN 6 125360766 missense probably benign 0.44
R1302:Tnfrsf1a UTSW 6 125356916 missense probably damaging 1.00
R2189:Tnfrsf1a UTSW 6 125357805 missense probably benign 0.42
R4559:Tnfrsf1a UTSW 6 125360766 missense probably benign 0.44
R4794:Tnfrsf1a UTSW 6 125358084 missense probably damaging 1.00
R5039:Tnfrsf1a UTSW 6 125360712 missense possibly damaging 0.67
R5364:Tnfrsf1a UTSW 6 125357393 missense possibly damaging 0.87
R5792:Tnfrsf1a UTSW 6 125358077 missense probably damaging 1.00
R6742:Tnfrsf1a UTSW 6 125356948 missense probably damaging 0.99
R7018:Tnfrsf1a UTSW 6 125356951 missense probably damaging 1.00
R7128:Tnfrsf1a UTSW 6 125361536 missense probably benign 0.11
R7192:Tnfrsf1a UTSW 6 125361596 missense unknown
R7715:Tnfrsf1a UTSW 6 125361414 missense possibly damaging 0.65
R8745:Tnfrsf1a UTSW 6 125361782 missense probably damaging 0.99
R8755:Tnfrsf1a UTSW 6 125357805 missense probably benign 0.42
R9005:Tnfrsf1a UTSW 6 125356915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGCTCGTGAGTGTGGC -3'
(R):5'- TGCCACATAGGAGCTCAGAC -3'

Sequencing Primer
(F):5'- GGCGGTAGTATGCATGCG -3'
(R):5'- CTCAGACACACAGACAGGATAGG -3'
Posted On 2021-07-15