Incidental Mutation 'R0731:Dcaf8'
ID 67534
Institutional Source Beutler Lab
Gene Symbol Dcaf8
Ensembl Gene ENSMUSG00000026554
Gene Name DDB1 and CUL4 associated factor 8
Synonyms D1Ucla4, D1Dau35e, Wdr42a, H326
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.840) question?
Stock # R0731 (G1)
Quality Score 181
Status Validated
Chromosome 1
Chromosomal Location 171975574-172023960 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 172000076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 78 (D78V)
Ref Sequence ENSEMBL: ENSMUSP00000141836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074144] [ENSMUST00000191689] [ENSMUST00000192704] [ENSMUST00000193638]
AlphaFold Q8N7N5
Predicted Effect possibly damaging
Transcript: ENSMUST00000074144
AA Change: D78V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073778
Gene: ENSMUSG00000026554
AA Change: D78V

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191689
AA Change: D78V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141731
Gene: ENSMUSG00000026554
AA Change: D78V

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192031
Predicted Effect possibly damaging
Transcript: ENSMUST00000192704
AA Change: D78V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141732
Gene: ENSMUSG00000026554
AA Change: D78V

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193638
AA Change: D78V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141836
Gene: ENSMUSG00000026554
AA Change: D78V

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195011
Predicted Effect probably benign
Transcript: ENSMUST00000195345
Meta Mutation Damage Score 0.4529 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Dcaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03163:Dcaf8 APN 1 172,000,475 (GRCm39) missense probably damaging 1.00
FR4976:Dcaf8 UTSW 1 172,000,423 (GRCm39) missense probably damaging 1.00
PIT4362001:Dcaf8 UTSW 1 172,000,364 (GRCm39) missense probably damaging 0.96
R0329:Dcaf8 UTSW 1 172,014,978 (GRCm39) missense probably benign 0.42
R0458:Dcaf8 UTSW 1 172,001,610 (GRCm39) missense probably benign 0.00
R0729:Dcaf8 UTSW 1 172,000,221 (GRCm39) missense probably benign
R1389:Dcaf8 UTSW 1 172,001,619 (GRCm39) missense probably benign 0.00
R1496:Dcaf8 UTSW 1 172,021,422 (GRCm39) missense probably benign 0.39
R1719:Dcaf8 UTSW 1 172,003,062 (GRCm39) missense probably damaging 0.96
R1856:Dcaf8 UTSW 1 172,003,120 (GRCm39) missense probably damaging 1.00
R2342:Dcaf8 UTSW 1 172,013,928 (GRCm39) missense possibly damaging 0.48
R2512:Dcaf8 UTSW 1 172,016,602 (GRCm39) missense possibly damaging 0.95
R4163:Dcaf8 UTSW 1 172,020,137 (GRCm39) missense probably damaging 1.00
R4546:Dcaf8 UTSW 1 172,007,460 (GRCm39) splice site probably benign
R4880:Dcaf8 UTSW 1 172,015,056 (GRCm39) intron probably benign
R5092:Dcaf8 UTSW 1 172,014,476 (GRCm39) missense probably benign 0.02
R5622:Dcaf8 UTSW 1 172,013,965 (GRCm39) intron probably benign
R5734:Dcaf8 UTSW 1 172,000,478 (GRCm39) missense possibly damaging 0.65
R6245:Dcaf8 UTSW 1 171,993,434 (GRCm39) start codon destroyed probably benign 0.01
R7090:Dcaf8 UTSW 1 172,016,535 (GRCm39) missense probably damaging 0.96
R8178:Dcaf8 UTSW 1 172,013,886 (GRCm39) missense probably benign 0.22
R8734:Dcaf8 UTSW 1 172,021,427 (GRCm39) missense probably benign 0.01
R8978:Dcaf8 UTSW 1 172,022,124 (GRCm39) missense probably benign 0.00
R8985:Dcaf8 UTSW 1 172,000,199 (GRCm39) missense probably benign
R9014:Dcaf8 UTSW 1 172,007,530 (GRCm39) missense possibly damaging 0.93
R9423:Dcaf8 UTSW 1 172,007,524 (GRCm39) missense probably damaging 1.00
R9500:Dcaf8 UTSW 1 171,999,909 (GRCm39) missense possibly damaging 0.63
Z1176:Dcaf8 UTSW 1 172,000,496 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGTTCAGGAAGTCTGTCCAGCAGC -3'
(R):5'- GGTATTGACACAACCAGTATGGCCC -3'

Sequencing Primer
(F):5'- TGTCCAGCAGCCCAGAG -3'
(R):5'- AAGGCTGTTGTCTCTGAAGATACC -3'
Posted On 2013-09-03