Incidental Mutation 'R8856:Golga4'
ID 675347
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 068737-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8856 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118385779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 967 (N967S)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000084820
AA Change: N967S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: N967S

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211840
Predicted Effect possibly damaging
Transcript: ENSMUST00000212097
AA Change: N939S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G A 6: 121,618,349 (GRCm39) R214H probably benign Het
Abca4 A G 3: 121,906,096 (GRCm39) S822G probably benign Het
Adgrv1 T A 13: 81,707,621 (GRCm39) I1262F probably benign Het
Agbl2 A G 2: 90,632,088 (GRCm39) D482G probably damaging Het
Asph T A 4: 9,630,947 (GRCm39) T134S possibly damaging Het
Cacna1a C T 8: 85,286,070 (GRCm39) A905V probably benign Het
Cacna1b C T 2: 24,569,530 (GRCm39) R798H probably benign Het
Cpne8 G T 15: 90,486,044 (GRCm39) Q140K probably benign Het
Crocc2 A T 1: 93,120,847 (GRCm39) N538I probably benign Het
Cyp2j9 T A 4: 96,462,184 (GRCm39) I366F probably damaging Het
Dchs1 A T 7: 105,410,064 (GRCm39) D1769E probably damaging Het
Def6 A T 17: 28,435,972 (GRCm39) I44F probably damaging Het
Dnah7a G A 1: 53,462,422 (GRCm39) T3723M probably damaging Het
Ecd T A 14: 20,387,140 (GRCm39) Y198F probably damaging Het
Ecel1 A C 1: 87,079,760 (GRCm39) M451R probably damaging Het
Eea1 A G 10: 95,831,506 (GRCm39) D199G probably benign Het
Efna5 A T 17: 62,914,374 (GRCm39) I217N unknown Het
F13a1 A T 13: 37,100,859 (GRCm39) D428E probably damaging Het
Fads1 T G 19: 10,170,276 (GRCm39) I272S probably benign Het
Fam149a C T 8: 45,834,611 (GRCm39) A63T Het
Fam83a A T 15: 57,872,977 (GRCm39) N269Y probably damaging Het
Fasn G A 11: 120,708,979 (GRCm39) T568I possibly damaging Het
Fbn1 A G 2: 125,156,637 (GRCm39) S2363P probably damaging Het
Fbxl4 T A 4: 22,390,803 (GRCm39) W329R probably damaging Het
Fgf12 A T 16: 28,008,233 (GRCm39) V189E probably damaging Het
Frmd4b A T 6: 97,269,359 (GRCm39) Y984* probably null Het
Galm A G 17: 80,490,661 (GRCm39) T273A possibly damaging Het
Gm43302 A G 5: 105,438,739 (GRCm39) S50P probably damaging Het
Gm45861 C T 8: 28,010,788 (GRCm39) S561L unknown Het
Gnao1 A G 8: 94,538,045 (GRCm39) I28V probably benign Het
Gpr155 A T 2: 73,203,993 (GRCm39) F274I probably benign Het
Grm1 A C 10: 10,595,092 (GRCm39) N845K probably damaging Het
Hnrnpa2b1 A T 6: 51,443,120 (GRCm39) probably null Het
Hsf4 G T 8: 105,996,628 (GRCm39) D18Y probably null Het
Htt T A 5: 35,060,675 (GRCm39) D2774E probably benign Het
Iars2 A G 1: 185,028,621 (GRCm39) I679T probably benign Het
Irf4 T C 13: 30,945,414 (GRCm39) F387L probably damaging Het
Itgb5 A G 16: 33,720,962 (GRCm39) Y342C probably damaging Het
Kcnmb4 A G 10: 116,282,299 (GRCm39) W133R possibly damaging Het
Ldhc A T 7: 46,525,999 (GRCm39) H271L probably benign Het
Lmtk2 C A 5: 144,113,079 (GRCm39) D1266E probably damaging Het
Lrrtm1 C A 6: 77,221,807 (GRCm39) N421K possibly damaging Het
Ly9 G A 1: 171,432,587 (GRCm39) T142I probably benign Het
Manba A G 3: 135,223,764 (GRCm39) Y217C probably damaging Het
Mapkbp1 T C 2: 119,845,109 (GRCm39) L330P probably damaging Het
Marchf2 A T 17: 33,915,165 (GRCm39) V143E probably benign Het
Mmel1 A T 4: 154,969,478 (GRCm39) D191V possibly damaging Het
Mrgpra1 A T 7: 46,985,583 (GRCm39) I32N probably benign Het
Mroh2b C T 15: 4,960,510 (GRCm39) Q748* probably null Het
Mrpl34 T G 8: 71,918,024 (GRCm39) W66G probably damaging Het
Muc21 T C 17: 35,931,865 (GRCm39) T774A unknown Het
Nde1 T A 16: 14,001,446 (GRCm39) S165T Het
Nek10 T G 14: 14,937,610 (GRCm38) I776M probably damaging Het
Nell2 A G 15: 95,281,552 (GRCm39) S385P probably damaging Het
Nsf A T 11: 103,821,568 (GRCm39) F29Y possibly damaging Het
Nsmaf A T 4: 6,433,320 (GRCm39) Y133* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or14j8 A T 17: 38,263,091 (GRCm39) S275T possibly damaging Het
Pcdhb8 A G 18: 37,489,776 (GRCm39) I485V probably benign Het
Poteg T A 8: 27,938,033 (GRCm39) M1K probably null Het
Pramel24 A T 4: 143,453,303 (GRCm39) N137I probably benign Het
Prdm5 G A 6: 65,860,569 (GRCm39) V418I possibly damaging Het
Psmc6 T A 14: 45,578,320 (GRCm39) C228S probably damaging Het
Ptgfrn C T 3: 100,963,927 (GRCm39) A562T possibly damaging Het
Ralgapa2 G T 2: 146,184,139 (GRCm39) Q1576K probably benign Het
Ranbp9 C T 13: 43,567,506 (GRCm39) G400D probably damaging Het
Rgs11 A T 17: 26,423,484 (GRCm39) I134F probably damaging Het
Rnf150 T A 8: 83,762,715 (GRCm39) C317S probably damaging Het
Rrm2b G A 15: 37,960,858 (GRCm39) probably benign Het
Scai T C 2: 38,996,978 (GRCm39) Q272R probably benign Het
Sec62 C T 3: 30,847,506 (GRCm39) R4C possibly damaging Het
Sgo2b C A 8: 64,393,091 (GRCm39) L115F probably null Het
Slc44a3 G A 3: 121,307,456 (GRCm39) P177S probably damaging Het
Slc45a4 G A 15: 73,457,966 (GRCm39) L528F probably damaging Het
Slco1a1 G T 6: 141,857,624 (GRCm39) A569D probably damaging Het
Stam2 G T 2: 52,604,984 (GRCm39) Q184K probably damaging Het
Tada2b A T 5: 36,641,166 (GRCm39) L79Q probably damaging Het
Tecpr1 T C 5: 144,153,117 (GRCm39) E204G possibly damaging Het
Tecta A T 9: 42,284,597 (GRCm39) D829E probably benign Het
Tepsin A G 11: 119,982,654 (GRCm39) V472A probably benign Het
Tnfrsf1a G A 6: 125,334,688 (GRCm39) M109I possibly damaging Het
Trim42 A T 9: 97,245,275 (GRCm39) Y508* probably null Het
Trmo T G 4: 46,387,625 (GRCm39) N65T probably benign Het
Tspear G T 10: 77,665,471 (GRCm39) E86* probably null Het
Ubr1 A T 2: 120,734,523 (GRCm39) S1126T probably damaging Het
Usp50 C A 2: 126,622,477 (GRCm39) D28Y probably damaging Het
Utp6 T A 11: 79,842,455 (GRCm39) I225F probably benign Het
Utrn T C 10: 12,543,351 (GRCm39) T1766A probably benign Het
Vcl T A 14: 21,045,160 (GRCm39) N288K probably benign Het
Vmn2r69 T C 7: 85,061,663 (GRCm39) N104D probably benign Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zfhx4 T A 3: 5,455,484 (GRCm39) S1159R probably benign Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCAGAGAGCTCAAGTGCAGC -3'
(R):5'- GTGCCATTTCCAGGATCTGC -3'

Sequencing Primer
(F):5'- TCACAGCTCAAGAACAGTACTGTGG -3'
(R):5'- CAGGATCTGCGCATTGAACTG -3'
Posted On 2021-07-15