Mutagenetix > Incidental Mutations

Incidental Mutation 'R0731:Snrnp200'

67538

Institutional Source

Beutler Lab

Gene Symbol

Snrnp200

Ensembl Gene

ENSMUSG00000003660

Gene Name

small nuclear ribonucleoprotein 200 (U5)

Synonyms

HELIC2, U5-200KD, A330064G03Rik, Ascc3l1

MMRRC Submission

038912-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0731 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127208386-127240451 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 127226145 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099509 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103220]

Predicted Effect

probably benign
Transcript: ENSMUST00000103220

SMART Domains

Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660

Domain	Start	End	E-Value	Type
low complexity region	65	78	N/A	INTRINSIC
low complexity region	206	223	N/A	INTRINSIC
low complexity region	373	386	N/A	INTRINSIC
DEXDc	477	690	2.63e-30	SMART
AAA	495	680	5.77e-2	SMART
HELICc	768	860	3.76e-17	SMART
low complexity region	876	887	N/A	INTRINSIC
Sec63	981	1286	2.62e-128	SMART
DEXDc	1324	1528	1.43e-31	SMART
AAA	1342	1533	2.39e0	SMART
HELICc	1607	1695	1.26e-9	SMART
Sec63	1812	2124	1.39e-118	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142327

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,586,203	T66A	probably damaging	Het
4933406M09Rik	A	C	1: 134,389,975	M162L	probably benign	Het
Acsm3	A	T	7: 119,768,024	R27*	probably null	Het
Actg1	A	G	11: 120,346,949	F255S	probably damaging	Het
Ahdc1	T	A	4: 133,062,951	V501E	possibly damaging	Het
Alpk2	A	T	18: 65,305,390	D1444E	probably damaging	Het
Btaf1	T	G	19: 36,997,495		probably null	Het
Cacnb2	A	G	2: 14,985,706	H489R	possibly damaging	Het
Ccdc162	C	A	10: 41,579,143	K398N	probably damaging	Het
Cd79b	G	T	11: 106,312,433	S145R	probably damaging	Het
Cdh11	T	A	8: 102,668,019	N264Y	probably damaging	Het
Celsr1	T	C	15: 85,901,597	D2892G	probably benign	Het
Chuk	A	G	19: 44,103,766		probably benign	Het
Clk3	T	C	9: 57,751,126		probably benign	Het
Dcaf8	A	T	1: 172,172,509	D78V	possibly damaging	Het
Dctn1	A	G	6: 83,183,089	T87A	probably damaging	Het
Ddx50	T	C	10: 62,616,249	N732D	unknown	Het
Dnah5	A	T	15: 28,311,143	Y1756F	possibly damaging	Het
Dock3	A	T	9: 106,969,856	V858E	probably damaging	Het
Fer1l4	A	G	2: 156,024,070	F1566S	probably benign	Het
Fpr-rs7	T	C	17: 20,113,854	I125V	probably benign	Het
Fuca2	C	T	10: 13,506,027	P228L	probably benign	Het
Galntl6	A	G	8: 58,535,984	F57L	probably benign	Het
Gigyf2	T	A	1: 87,407,727		probably benign	Het
Gm16505	A	T	13: 3,361,329		noncoding transcript	Het
Gm4781	T	C	10: 100,396,777		noncoding transcript	Het
Gm9956	T	A	10: 56,745,543	Y100*	probably null	Het
Gpr137c	T	A	14: 45,246,349	C178S	probably damaging	Het
Gpr83	A	G	9: 14,868,644	R331G	probably benign	Het
Hlcs	T	A	16: 94,131,852	H851L	probably damaging	Het
Kbtbd6	C	A	14: 79,451,884	Y6*	probably null	Het
Kif23	T	C	9: 61,925,032	R610G	possibly damaging	Het
Kifc3	G	A	8: 95,105,733	T487I	probably damaging	Het
Klra5	A	C	6: 129,908,796	D133E	possibly damaging	Het
Klra6	T	C	6: 130,022,705	E100G	probably damaging	Het
Klre1	T	A	6: 129,585,568		probably benign	Het
Lancl1	C	T	1: 67,009,910		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Man1b1	A	G	2: 25,338,155	I146V	possibly damaging	Het
Map4k5	T	A	12: 69,874,264		probably benign	Het
Mast3	A	G	8: 70,781,321	S178P	probably damaging	Het
Mau2	A	G	8: 70,023,612		probably null	Het
Mkrn2	A	T	6: 115,614,651	N312Y	probably damaging	Het
Mrvi1	T	C	7: 110,876,900	S615G	probably benign	Het
Myh1	A	G	11: 67,202,533	E150G	probably damaging	Het
Myo7b	T	A	18: 31,961,825		probably null	Het
Nyap1	A	G	5: 137,735,298	V491A	probably damaging	Het
Olfr1284	A	G	2: 111,379,293	M98V	probably damaging	Het
Olfr484	T	C	7: 108,124,734	I176M	probably benign	Het
Olfr518	A	T	7: 108,881,533	N24K	probably damaging	Het
Olfr954	T	C	9: 39,461,532	F34L	probably damaging	Het
Oxsm	A	T	14: 16,240,893	H385Q	probably damaging	Het
Pbld2	T	C	10: 63,056,811	S242P	probably damaging	Het
Pdzd7	T	C	19: 45,029,305	Y675C	probably damaging	Het
Pnkd	T	A	1: 74,351,541	H266Q	probably damaging	Het
Rbfox2	A	G	15: 77,099,279	S141P	probably benign	Het
Rdx	A	G	9: 52,068,218	T214A	probably benign	Het
Ripor2	A	T	13: 24,680,644	E219V	probably damaging	Het
Rufy2	G	A	10: 63,011,844		probably benign	Het
Slf2	T	A	19: 44,975,726		probably benign	Het
Snx7	T	A	3: 117,829,671		probably benign	Het
Stt3a	T	C	9: 36,735,512	I602V	probably damaging	Het
Tacr3	G	A	3: 134,855,000		probably null	Het
Tcerg1	C	T	18: 42,571,840	T978M	probably damaging	Het
Tcf7l1	G	T	6: 72,788,269	P126Q	possibly damaging	Het
Trank1	A	G	9: 111,365,488	D860G	probably damaging	Het
Try4	T	C	6: 41,304,367	L81P	probably benign	Het
Ucp1	T	C	8: 83,297,847		probably benign	Het
Ugt2b38	G	A	5: 87,420,452	A328V	probably damaging	Het
Wfikkn1	T	A	17: 25,878,017	R444S	probably damaging	Het
Zfc3h1	A	G	10: 115,410,632	T875A	probably benign	Het
Zfp11	A	G	5: 129,657,264	S378P	probably damaging	Het
Zfp984	T	A	4: 147,756,232	N54I	probably damaging	Het

Other mutations in Snrnp200

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Snrnp200	APN	2	127230135	missense	possibly damaging	0.80
IGL01013:Snrnp200	APN	2	127232472	missense	probably damaging	1.00
IGL01073:Snrnp200	APN	2	127214912	splice site	probably benign
IGL01319:Snrnp200	APN	2	127230127	splice site	probably benign
IGL01597:Snrnp200	APN	2	127238732	unclassified	probably benign
IGL01631:Snrnp200	APN	2	127238824	unclassified	probably benign
IGL01646:Snrnp200	APN	2	127222228	missense	probably benign	0.00
IGL02019:Snrnp200	APN	2	127232905	missense	possibly damaging	0.94
IGL02158:Snrnp200	APN	2	127237483	missense	probably benign	0.05
IGL02269:Snrnp200	APN	2	127229991	missense	possibly damaging	0.67
IGL02288:Snrnp200	APN	2	127229895	missense	probably damaging	1.00
IGL02437:Snrnp200	APN	2	127216110	missense	probably damaging	1.00
IGL02476:Snrnp200	APN	2	127217488	missense	probably benign	0.41
IGL02613:Snrnp200	APN	2	127218426	missense	probably damaging	0.98
IGL02898:Snrnp200	APN	2	127216756	splice site	probably benign
IGL03108:Snrnp200	APN	2	127238167	missense	possibly damaging	0.82
IGL03143:Snrnp200	APN	2	127230042	critical splice donor site	probably benign
IGL03237:Snrnp200	APN	2	127233313	missense	probably damaging	0.99
R0012:Snrnp200	UTSW	2	127228549	missense	probably benign	0.35
R0012:Snrnp200	UTSW	2	127228549	missense	probably benign	0.35
R0033:Snrnp200	UTSW	2	127238063	missense	probably damaging	0.97
R0033:Snrnp200	UTSW	2	127238063	missense	probably damaging	0.97
R0047:Snrnp200	UTSW	2	127234954	splice site	probably benign
R0047:Snrnp200	UTSW	2	127234954	splice site	probably benign
R0057:Snrnp200	UTSW	2	127237907	missense	probably damaging	0.96
R0270:Snrnp200	UTSW	2	127232982	missense	probably damaging	0.97
R0626:Snrnp200	UTSW	2	127221814	missense	possibly damaging	0.46
R1175:Snrnp200	UTSW	2	127229077	missense	probably damaging	1.00
R1184:Snrnp200	UTSW	2	127236817	missense	probably damaging	1.00
R1383:Snrnp200	UTSW	2	127218411	missense	probably benign	0.10
R1444:Snrnp200	UTSW	2	127228238	splice site	probably benign
R1757:Snrnp200	UTSW	2	127232443	missense	probably damaging	1.00
R1794:Snrnp200	UTSW	2	127216736	missense	probably benign
R1808:Snrnp200	UTSW	2	127219027	critical splice acceptor site	probably null
R1808:Snrnp200	UTSW	2	127219028	critical splice acceptor site	probably null
R1957:Snrnp200	UTSW	2	127216175	missense	possibly damaging	0.69
R2007:Snrnp200	UTSW	2	127227048	missense	probably damaging	1.00
R2039:Snrnp200	UTSW	2	127234984	missense	probably benign	0.19
R2070:Snrnp200	UTSW	2	127212403	missense	possibly damaging	0.89
R2070:Snrnp200	UTSW	2	127237883	missense	probably benign	0.00
R2892:Snrnp200	UTSW	2	127231777	missense	probably damaging	0.99
R3236:Snrnp200	UTSW	2	127221882	missense	probably damaging	1.00
R3862:Snrnp200	UTSW	2	127233099	splice site	probably benign
R4028:Snrnp200	UTSW	2	127237566	missense	probably damaging	0.99
R4105:Snrnp200	UTSW	2	127228016	missense	probably damaging	1.00
R4328:Snrnp200	UTSW	2	127222217	missense	probably damaging	0.99
R4471:Snrnp200	UTSW	2	127238753	missense	probably benign	0.03
R4526:Snrnp200	UTSW	2	127229102	missense	probably benign
R4575:Snrnp200	UTSW	2	127235066	missense	probably benign	0.00
R4710:Snrnp200	UTSW	2	127226133	missense	probably damaging	1.00
R4728:Snrnp200	UTSW	2	127217414	missense	probably damaging	1.00
R4728:Snrnp200	UTSW	2	127227878	missense	possibly damaging	0.89
R4729:Snrnp200	UTSW	2	127232937	missense	probably damaging	0.99
R4828:Snrnp200	UTSW	2	127211607	missense	probably damaging	0.99
R5082:Snrnp200	UTSW	2	127226370	nonsense	probably null
R5213:Snrnp200	UTSW	2	127231741	missense	probably damaging	1.00
R5287:Snrnp200	UTSW	2	127231687	missense	probably benign	0.13
R5486:Snrnp200	UTSW	2	127233066	missense	possibly damaging	0.82
R5595:Snrnp200	UTSW	2	127226013	missense	probably damaging	0.99
R5598:Snrnp200	UTSW	2	127226087	missense	possibly damaging	0.64
R5681:Snrnp200	UTSW	2	127225135	missense	probably damaging	1.00
R6207:Snrnp200	UTSW	2	127210735	missense	probably benign	0.00
R6258:Snrnp200	UTSW	2	127218423	missense	possibly damaging	0.60
R6259:Snrnp200	UTSW	2	127218423	missense	possibly damaging	0.60
R6299:Snrnp200	UTSW	2	127222161	nonsense	probably null
R6434:Snrnp200	UTSW	2	127238654	missense	probably damaging	1.00
R6522:Snrnp200	UTSW	2	127221827	missense	probably benign	0.12
R6647:Snrnp200	UTSW	2	127226452	missense	probably damaging	1.00
R6785:Snrnp200	UTSW	2	127229165	missense	possibly damaging	0.70
R7027:Snrnp200	UTSW	2	127217272	missense	probably benign	0.09
R7358:Snrnp200	UTSW	2	127221826	missense	probably benign	0.03
R7436:Snrnp200	UTSW	2	127226484	critical splice donor site	probably null
R7587:Snrnp200	UTSW	2	127227902	missense	probably damaging	1.00
R7672:Snrnp200	UTSW	2	127221902	missense	probably damaging	1.00
R7731:Snrnp200	UTSW	2	127229102	missense	probably benign
R7841:Snrnp200	UTSW	2	127236834	missense	probably benign	0.23
R7863:Snrnp200	UTSW	2	127231689	missense	probably damaging	1.00
R7916:Snrnp200	UTSW	2	127233059	missense	possibly damaging	0.51
R8117:Snrnp200	UTSW	2	127229131	missense	probably benign
R8262:Snrnp200	UTSW	2	127227008	missense	probably damaging	1.00
R8551:Snrnp200	UTSW	2	127227051	missense	probably benign	0.03
R8675:Snrnp200	UTSW	2	127232523	missense	possibly damaging	0.94
R8754:Snrnp200	UTSW	2	127226085	missense	probably damaging	1.00
R8852:Snrnp200	UTSW	2	127218429	missense	probably damaging	0.99
R8899:Snrnp200	UTSW	2	127236597	missense	probably damaging	1.00
R8937:Snrnp200	UTSW	2	127226982	missense	probably benign	0.04
RF016:Snrnp200	UTSW	2	127230556	missense	probably damaging	1.00
Z1176:Snrnp200	UTSW	2	127234975	missense	probably benign	0.10
Z1177:Snrnp200	UTSW	2	127236031	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GGTTAAGCTCAGGCACCAGACAAG -3'
(R):5'- TGGAGACCATCTGGCTCTCGATAG -3'

Sequencing Primer
(F):5'- GCGAAGGATATGGCCCTG -3'
(R):5'- ATGTGATGAGGATGCCTTCACC -3'

Posted On

2013-09-03