Incidental Mutation 'R0731:Fer1l4'
ID 67539
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0731 (G1)
Quality Score 177
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155865990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1566 (F1566S)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109611
AA Change: F1566S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: F1566S

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCATTTTCTCCCAACATCCAGG -3'
(R):5'- CAGGACCATTGCTGTTTCCAAAAGG -3'

Sequencing Primer
(F):5'- AGGAATCTTGTCCTAACTCAGC -3'
(R):5'- TCTGGTATCCAAGACCTGAGC -3'
Posted On 2013-09-03