Incidental Mutation 'R8857:Slc7a11'
ID 675395
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms sut, System x, x, 9930009M05Rik, xCT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8857 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 49892526-50443614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50438856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 113 (Y113H)
Ref Sequence ENSEMBL: ENSMUSP00000029297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
AlphaFold Q9WTR6
Predicted Effect probably damaging
Transcript: ENSMUST00000029297
AA Change: Y113H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: Y113H

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194462
AA Change: Y113H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: Y113H

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,130,855 L266F possibly damaging Het
Adgrf3 A T 5: 30,197,067 C654* probably null Het
Adgrl1 C A 8: 83,931,028 A421D probably benign Het
Adra1b C G 11: 43,836,265 probably benign Het
Apba2 T A 7: 64,750,191 V710E possibly damaging Het
Arhgef5 T C 6: 43,287,624 V1523A probably damaging Het
AW551984 G C 9: 39,600,535 A60G probably damaging Het
Bdh1 A T 16: 31,446,632 T42S probably benign Het
C130073F10Rik G A 4: 101,890,358 P158L possibly damaging Het
Cacna2d4 A T 6: 119,271,948 K457* probably null Het
Cd3eap C T 7: 19,359,430 probably benign Het
Chd3 G A 11: 69,362,320 P223L probably benign Het
Cnst T C 1: 179,610,313 S481P probably damaging Het
Col6a3 T A 1: 90,775,763 K3027N unknown Het
Csf2rb2 T C 15: 78,294,413 D111G probably null Het
Disc1 A C 8: 125,165,131 E641A probably damaging Het
Fbln5 C A 12: 101,760,731 C320F probably damaging Het
Fbn2 G A 18: 58,153,861 T242I probably damaging Het
Frem1 T A 4: 83,004,043 probably benign Het
Gpsm1 G C 2: 26,340,445 G469A possibly damaging Het
Hic1 A G 11: 75,165,402 I887T probably benign Het
Hltf T C 3: 20,105,661 V692A probably damaging Het
Hsd17b13 A G 5: 103,977,197 L40P probably damaging Het
Hydin T C 8: 110,571,955 probably null Het
Irf2bpl T C 12: 86,882,585 Y438C possibly damaging Het
Itgb4 A T 11: 115,981,027 N219I probably benign Het
Knop1 T C 7: 118,852,726 K257E Het
Krtap19-5 A T 16: 88,896,251 F58I unknown Het
L3mbtl2 T A 15: 81,687,119 F709L unknown Het
Map1a G A 2: 121,307,617 R2924H probably damaging Het
Mfsd13a A G 19: 46,368,128 D224G probably benign Het
Mme A T 3: 63,348,649 N510I probably damaging Het
Morc2a T A 11: 3,677,484 probably null Het
Mptx2 T C 1: 173,274,885 E79G probably benign Het
Nutm1 A G 2: 112,251,178 M380T probably benign Het
Olfr209 A T 16: 59,361,678 I180N probably damaging Het
P2rx1 A G 11: 73,012,371 probably benign Het
Padi4 A G 4: 140,774,161 I7T probably damaging Het
Phf20l1 T C 15: 66,641,932 S1013P probably benign Het
Plb1 T C 5: 32,364,212 V1469A unknown Het
Prkab1 T C 5: 116,020,088 N150D probably damaging Het
Qsox1 A G 1: 155,782,587 V412A possibly damaging Het
Rai1 A G 11: 60,186,567 S486G probably benign Het
Rev3l T A 10: 39,794,969 Y170* probably null Het
Rims2 T A 15: 39,679,648 M1426K possibly damaging Het
Selenoi C A 5: 30,256,162 S132* probably null Het
Shtn1 T C 19: 58,990,368 I498M probably damaging Het
Sin3b T C 8: 72,756,895 M970T probably benign Het
Slc17a8 A G 10: 89,591,160 F360L probably damaging Het
Spast T A 17: 74,368,943 M327K possibly damaging Het
Sphkap T A 1: 83,280,567 I152F probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tiam1 A T 16: 89,865,257 S658T probably damaging Het
Tmem174 G T 13: 98,636,925 H132Q probably damaging Het
Tnfrsf10b G A 14: 69,775,094 V117I probably benign Het
Tnr A G 1: 159,886,158 T719A probably benign Het
Tomm34 G A 2: 164,054,459 P292S probably damaging Het
Trav15-1-dv6-1 T A 14: 53,560,158 F88Y probably damaging Het
Trp63 A T 16: 25,820,476 H138L probably damaging Het
U2af2 T A 7: 5,062,291 S2T probably damaging Het
Uroc1 T C 6: 90,357,528 V574A possibly damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp488 A C 14: 33,970,803 S134R probably benign Het
Zfp950 T C 19: 61,127,563 D2G probably benign Het
Zfyve1 T A 12: 83,551,600 H618L probably damaging Het
Zp1 T G 19: 10,916,524 D439A probably damaging Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50384051 missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2128:Slc7a11 UTSW 3 50384109 missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R4479:Slc7a11 UTSW 3 50417963 intron probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50438875 missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50424052 missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50417986 critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
R8967:Slc7a11 UTSW 3 50384115 missense probably benign 0.00
R9044:Slc7a11 UTSW 3 50379183 missense probably benign 0.20
R9104:Slc7a11 UTSW 3 50377633 missense probably benign 0.01
R9404:Slc7a11 UTSW 3 50381039 missense possibly damaging 0.64
R9500:Slc7a11 UTSW 3 50427752 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTAGGGTCTGTATTTGTTCAAC -3'
(R):5'- GTGGGTCTCAGTTAGAAGATGAC -3'

Sequencing Primer
(F):5'- AGGGTCTGTATTTGTTCAACTAAGTC -3'
(R):5'- GATGACAACTGTTCCCATGAAGGTC -3'
Posted On 2021-07-15