Incidental Mutation 'R8857:C130073F10Rik'
ID 675397
Institutional Source Beutler Lab
Gene Symbol C130073F10Rik
Ensembl Gene ENSMUSG00000046133
Gene Name RIKEN cDNA C130073F10 gene
Synonyms
MMRRC Submission 068677-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8857 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 101747217-101750986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101747555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 158 (P158L)
Ref Sequence ENSEMBL: ENSMUSP00000059092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051043]
AlphaFold Q8C4L8
Predicted Effect possibly damaging
Transcript: ENSMUST00000051043
AA Change: P158L

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,119,287 (GRCm39) L266F possibly damaging Het
Adgrf3 A T 5: 30,402,065 (GRCm39) C654* probably null Het
Adgrl1 C A 8: 84,657,657 (GRCm39) A421D probably benign Het
Adra1b C G 11: 43,727,092 (GRCm39) probably benign Het
Apba2 T A 7: 64,399,939 (GRCm39) V710E possibly damaging Het
Arhgef5 T C 6: 43,264,558 (GRCm39) V1523A probably damaging Het
AW551984 G C 9: 39,511,831 (GRCm39) A60G probably damaging Het
Bdh1 A T 16: 31,265,450 (GRCm39) T42S probably benign Het
Cacna2d4 A T 6: 119,248,909 (GRCm39) K457* probably null Het
Chd3 G A 11: 69,253,146 (GRCm39) P223L probably benign Het
Cnst T C 1: 179,437,878 (GRCm39) S481P probably damaging Het
Col6a3 T A 1: 90,703,485 (GRCm39) K3027N unknown Het
Csf2rb2 T C 15: 78,178,613 (GRCm39) D111G probably null Het
Disc1 A C 8: 125,891,870 (GRCm39) E641A probably damaging Het
Fbln5 C A 12: 101,726,990 (GRCm39) C320F probably damaging Het
Fbn2 G A 18: 58,286,933 (GRCm39) T242I probably damaging Het
Frem1 T A 4: 82,922,280 (GRCm39) probably benign Het
Gpsm1 G C 2: 26,230,457 (GRCm39) G469A possibly damaging Het
Hic1 A G 11: 75,056,228 (GRCm39) I887T probably benign Het
Hltf T C 3: 20,159,825 (GRCm39) V692A probably damaging Het
Hsd17b13 A G 5: 104,125,063 (GRCm39) L40P probably damaging Het
Hydin T C 8: 111,298,587 (GRCm39) probably null Het
Irf2bpl T C 12: 86,929,359 (GRCm39) Y438C possibly damaging Het
Itgb4 A T 11: 115,871,853 (GRCm39) N219I probably benign Het
Knop1 T C 7: 118,451,949 (GRCm39) K257E Het
Krtap19-5 A T 16: 88,693,139 (GRCm39) F58I unknown Het
L3mbtl2 T A 15: 81,571,320 (GRCm39) F709L unknown Het
Map1a G A 2: 121,138,098 (GRCm39) R2924H probably damaging Het
Mfsd13a A G 19: 46,356,567 (GRCm39) D224G probably benign Het
Mme A T 3: 63,256,070 (GRCm39) N510I probably damaging Het
Morc2a T A 11: 3,627,484 (GRCm39) probably null Het
Mptx2 T C 1: 173,102,452 (GRCm39) E79G probably benign Het
Nutm1 A G 2: 112,081,523 (GRCm39) M380T probably benign Het
Or5ac25 A T 16: 59,182,041 (GRCm39) I180N probably damaging Het
P2rx1 A G 11: 72,903,197 (GRCm39) probably benign Het
Padi4 A G 4: 140,501,472 (GRCm39) I7T probably damaging Het
Phf20l1 T C 15: 66,513,781 (GRCm39) S1013P probably benign Het
Plb1 T C 5: 32,521,556 (GRCm39) V1469A unknown Het
Polr1g C T 7: 19,093,355 (GRCm39) probably benign Het
Prkab1 T C 5: 116,158,147 (GRCm39) N150D probably damaging Het
Qsox1 A G 1: 155,658,333 (GRCm39) V412A possibly damaging Het
Rai1 A G 11: 60,077,393 (GRCm39) S486G probably benign Het
Rev3l T A 10: 39,670,965 (GRCm39) Y170* probably null Het
Rims2 T A 15: 39,543,044 (GRCm39) M1426K possibly damaging Het
Selenoi C A 5: 30,461,160 (GRCm39) S132* probably null Het
Shtn1 T C 19: 58,978,800 (GRCm39) I498M probably damaging Het
Sin3b T C 8: 73,483,523 (GRCm39) M970T probably benign Het
Slc17a8 A G 10: 89,427,022 (GRCm39) F360L probably damaging Het
Slc7a11 A G 3: 50,393,305 (GRCm39) Y113H probably damaging Het
Spast T A 17: 74,675,938 (GRCm39) M327K possibly damaging Het
Sphkap T A 1: 83,258,288 (GRCm39) I152F probably damaging Het
Tecpr1 T C 5: 144,153,117 (GRCm39) E204G possibly damaging Het
Tiam1 A T 16: 89,662,145 (GRCm39) S658T probably damaging Het
Tmem174 G T 13: 98,773,433 (GRCm39) H132Q probably damaging Het
Tnfrsf10b G A 14: 70,012,543 (GRCm39) V117I probably benign Het
Tnr A G 1: 159,713,728 (GRCm39) T719A probably benign Het
Tomm34 G A 2: 163,896,379 (GRCm39) P292S probably damaging Het
Trav15-1-dv6-1 T A 14: 53,797,615 (GRCm39) F88Y probably damaging Het
Trp63 A T 16: 25,639,226 (GRCm39) H138L probably damaging Het
U2af2 T A 7: 5,065,290 (GRCm39) S2T probably damaging Het
Uroc1 T C 6: 90,334,510 (GRCm39) V574A possibly damaging Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zfp488 A C 14: 33,692,760 (GRCm39) S134R probably benign Het
Zfp950 T C 19: 61,116,001 (GRCm39) D2G probably benign Het
Zfyve1 T A 12: 83,598,374 (GRCm39) H618L probably damaging Het
Zp1 T G 19: 10,893,888 (GRCm39) D439A probably damaging Het
Other mutations in C130073F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02805:C130073F10Rik APN 4 101,748,171 (GRCm39) start codon destroyed probably null 1.00
IGL02869:C130073F10Rik APN 4 101,747,590 (GRCm39) nonsense probably null
R0621:C130073F10Rik UTSW 4 101,747,992 (GRCm39) missense probably damaging 1.00
R1368:C130073F10Rik UTSW 4 101,747,953 (GRCm39) missense possibly damaging 0.78
R1471:C130073F10Rik UTSW 4 101,747,535 (GRCm39) missense probably benign 0.01
R4732:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R4733:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R5372:C130073F10Rik UTSW 4 101,747,684 (GRCm39) missense probably damaging 1.00
R5777:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R6510:C130073F10Rik UTSW 4 101,747,482 (GRCm39) missense probably benign 0.01
R6888:C130073F10Rik UTSW 4 101,747,453 (GRCm39) missense probably benign 0.12
R7229:C130073F10Rik UTSW 4 101,747,439 (GRCm39) missense probably benign 0.00
R8186:C130073F10Rik UTSW 4 101,748,031 (GRCm39) nonsense probably null
R8353:C130073F10Rik UTSW 4 101,747,881 (GRCm39) splice site probably null
R9559:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R9590:C130073F10Rik UTSW 4 101,747,618 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCAGCCTATGTCATGTGGTG -3'
(R):5'- AGAGGTCTATTTGCTGGATGCC -3'

Sequencing Primer
(F):5'- GAGCACAGACTACTCTTCAGTG -3'
(R):5'- ATTTGCTGGATGCCAACCATGAC -3'
Posted On 2021-07-15