Incidental Mutation 'R8857:Adgrf3'
ID 675399
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms Gpr113, LOC381628, PGR23
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8857 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 30193431-30205722 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 30197067 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 654 (C654*)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect probably null
Transcript: ENSMUST00000088117
AA Change: C654*
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: C654*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,130,855 L266F possibly damaging Het
Adgrl1 C A 8: 83,931,028 A421D probably benign Het
Adra1b C G 11: 43,836,265 probably benign Het
Apba2 T A 7: 64,750,191 V710E possibly damaging Het
Arhgef5 T C 6: 43,287,624 V1523A probably damaging Het
AW551984 G C 9: 39,600,535 A60G probably damaging Het
Bdh1 A T 16: 31,446,632 T42S probably benign Het
C130073F10Rik G A 4: 101,890,358 P158L possibly damaging Het
Cacna2d4 A T 6: 119,271,948 K457* probably null Het
Cd3eap C T 7: 19,359,430 probably benign Het
Chd3 G A 11: 69,362,320 P223L probably benign Het
Cnst T C 1: 179,610,313 S481P probably damaging Het
Col6a3 T A 1: 90,775,763 K3027N unknown Het
Csf2rb2 T C 15: 78,294,413 D111G probably null Het
Disc1 A C 8: 125,165,131 E641A probably damaging Het
Fbln5 C A 12: 101,760,731 C320F probably damaging Het
Fbn2 G A 18: 58,153,861 T242I probably damaging Het
Frem1 T A 4: 83,004,043 probably benign Het
Gpsm1 G C 2: 26,340,445 G469A possibly damaging Het
Hic1 A G 11: 75,165,402 I887T probably benign Het
Hltf T C 3: 20,105,661 V692A probably damaging Het
Hsd17b13 A G 5: 103,977,197 L40P probably damaging Het
Hydin T C 8: 110,571,955 probably null Het
Irf2bpl T C 12: 86,882,585 Y438C possibly damaging Het
Itgb4 A T 11: 115,981,027 N219I probably benign Het
Knop1 T C 7: 118,852,726 K257E Het
Krtap19-5 A T 16: 88,896,251 F58I unknown Het
L3mbtl2 T A 15: 81,687,119 F709L unknown Het
Map1a G A 2: 121,307,617 R2924H probably damaging Het
Mfsd13a A G 19: 46,368,128 D224G probably benign Het
Mme A T 3: 63,348,649 N510I probably damaging Het
Morc2a T A 11: 3,677,484 probably null Het
Mptx2 T C 1: 173,274,885 E79G probably benign Het
Nutm1 A G 2: 112,251,178 M380T probably benign Het
Olfr209 A T 16: 59,361,678 I180N probably damaging Het
P2rx1 A G 11: 73,012,371 probably benign Het
Padi4 A G 4: 140,774,161 I7T probably damaging Het
Phf20l1 T C 15: 66,641,932 S1013P probably benign Het
Plb1 T C 5: 32,364,212 V1469A unknown Het
Prkab1 T C 5: 116,020,088 N150D probably damaging Het
Qsox1 A G 1: 155,782,587 V412A possibly damaging Het
Rai1 A G 11: 60,186,567 S486G probably benign Het
Rev3l T A 10: 39,794,969 Y170* probably null Het
Rims2 T A 15: 39,679,648 M1426K possibly damaging Het
Selenoi C A 5: 30,256,162 S132* probably null Het
Shtn1 T C 19: 58,990,368 I498M probably damaging Het
Sin3b T C 8: 72,756,895 M970T probably benign Het
Slc17a8 A G 10: 89,591,160 F360L probably damaging Het
Slc7a11 A G 3: 50,438,856 Y113H probably damaging Het
Spast T A 17: 74,368,943 M327K possibly damaging Het
Sphkap T A 1: 83,280,567 I152F probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tiam1 A T 16: 89,865,257 S658T probably damaging Het
Tmem174 G T 13: 98,636,925 H132Q probably damaging Het
Tnfrsf10b G A 14: 69,775,094 V117I probably benign Het
Tnr A G 1: 159,886,158 T719A probably benign Het
Tomm34 G A 2: 164,054,459 P292S probably damaging Het
Trav15-1-dv6-1 T A 14: 53,560,158 F88Y probably damaging Het
Trp63 A T 16: 25,820,476 H138L probably damaging Het
U2af2 T A 7: 5,062,291 S2T probably damaging Het
Uroc1 T C 6: 90,357,528 V574A possibly damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp488 A C 14: 33,970,803 S134R probably benign Het
Zfp950 T C 19: 61,127,563 D2G probably benign Het
Zfyve1 T A 12: 83,551,600 H618L probably damaging Het
Zp1 T G 19: 10,916,524 D439A probably damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1695:Adgrf3 UTSW 5 30203555 missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30197314 missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30196524 missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30199512 missense probably damaging 1.00
R8281:Adgrf3 UTSW 5 30197303 missense possibly damaging 0.46
R8717:Adgrf3 UTSW 5 30198581 unclassified probably benign
R8926:Adgrf3 UTSW 5 30200448 missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30195073 missense possibly damaging 0.94
R9446:Adgrf3 UTSW 5 30196959 missense probably benign 0.01
R9522:Adgrf3 UTSW 5 30199484 missense possibly damaging 0.90
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGTAAATAGCCAGGCAGACG -3'
(R):5'- GTACTGCAAAAGCTGGACTACC -3'

Sequencing Primer
(F):5'- CAGGCAGACGAGCAAAGCC -3'
(R):5'- TACCGGCTGCCCTCAAAC -3'
Posted On 2021-07-15