Incidental Mutation 'R8857:Adgrf3'
ID 675399
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms PGR23, LOC381628, Gpr113
MMRRC Submission 068677-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8857 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 30398429-30410720 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 30402065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 654 (C654*)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect probably null
Transcript: ENSMUST00000088117
AA Change: C654*
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: C654*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,119,287 (GRCm39) L266F possibly damaging Het
Adgrl1 C A 8: 84,657,657 (GRCm39) A421D probably benign Het
Adra1b C G 11: 43,727,092 (GRCm39) probably benign Het
Apba2 T A 7: 64,399,939 (GRCm39) V710E possibly damaging Het
Arhgef5 T C 6: 43,264,558 (GRCm39) V1523A probably damaging Het
AW551984 G C 9: 39,511,831 (GRCm39) A60G probably damaging Het
Bdh1 A T 16: 31,265,450 (GRCm39) T42S probably benign Het
C130073F10Rik G A 4: 101,747,555 (GRCm39) P158L possibly damaging Het
Cacna2d4 A T 6: 119,248,909 (GRCm39) K457* probably null Het
Chd3 G A 11: 69,253,146 (GRCm39) P223L probably benign Het
Cnst T C 1: 179,437,878 (GRCm39) S481P probably damaging Het
Col6a3 T A 1: 90,703,485 (GRCm39) K3027N unknown Het
Csf2rb2 T C 15: 78,178,613 (GRCm39) D111G probably null Het
Disc1 A C 8: 125,891,870 (GRCm39) E641A probably damaging Het
Fbln5 C A 12: 101,726,990 (GRCm39) C320F probably damaging Het
Fbn2 G A 18: 58,286,933 (GRCm39) T242I probably damaging Het
Frem1 T A 4: 82,922,280 (GRCm39) probably benign Het
Gpsm1 G C 2: 26,230,457 (GRCm39) G469A possibly damaging Het
Hic1 A G 11: 75,056,228 (GRCm39) I887T probably benign Het
Hltf T C 3: 20,159,825 (GRCm39) V692A probably damaging Het
Hsd17b13 A G 5: 104,125,063 (GRCm39) L40P probably damaging Het
Hydin T C 8: 111,298,587 (GRCm39) probably null Het
Irf2bpl T C 12: 86,929,359 (GRCm39) Y438C possibly damaging Het
Itgb4 A T 11: 115,871,853 (GRCm39) N219I probably benign Het
Knop1 T C 7: 118,451,949 (GRCm39) K257E Het
Krtap19-5 A T 16: 88,693,139 (GRCm39) F58I unknown Het
L3mbtl2 T A 15: 81,571,320 (GRCm39) F709L unknown Het
Map1a G A 2: 121,138,098 (GRCm39) R2924H probably damaging Het
Mfsd13a A G 19: 46,356,567 (GRCm39) D224G probably benign Het
Mme A T 3: 63,256,070 (GRCm39) N510I probably damaging Het
Morc2a T A 11: 3,627,484 (GRCm39) probably null Het
Mptx2 T C 1: 173,102,452 (GRCm39) E79G probably benign Het
Nutm1 A G 2: 112,081,523 (GRCm39) M380T probably benign Het
Or5ac25 A T 16: 59,182,041 (GRCm39) I180N probably damaging Het
P2rx1 A G 11: 72,903,197 (GRCm39) probably benign Het
Padi4 A G 4: 140,501,472 (GRCm39) I7T probably damaging Het
Phf20l1 T C 15: 66,513,781 (GRCm39) S1013P probably benign Het
Plb1 T C 5: 32,521,556 (GRCm39) V1469A unknown Het
Polr1g C T 7: 19,093,355 (GRCm39) probably benign Het
Prkab1 T C 5: 116,158,147 (GRCm39) N150D probably damaging Het
Qsox1 A G 1: 155,658,333 (GRCm39) V412A possibly damaging Het
Rai1 A G 11: 60,077,393 (GRCm39) S486G probably benign Het
Rev3l T A 10: 39,670,965 (GRCm39) Y170* probably null Het
Rims2 T A 15: 39,543,044 (GRCm39) M1426K possibly damaging Het
Selenoi C A 5: 30,461,160 (GRCm39) S132* probably null Het
Shtn1 T C 19: 58,978,800 (GRCm39) I498M probably damaging Het
Sin3b T C 8: 73,483,523 (GRCm39) M970T probably benign Het
Slc17a8 A G 10: 89,427,022 (GRCm39) F360L probably damaging Het
Slc7a11 A G 3: 50,393,305 (GRCm39) Y113H probably damaging Het
Spast T A 17: 74,675,938 (GRCm39) M327K possibly damaging Het
Sphkap T A 1: 83,258,288 (GRCm39) I152F probably damaging Het
Tecpr1 T C 5: 144,153,117 (GRCm39) E204G possibly damaging Het
Tiam1 A T 16: 89,662,145 (GRCm39) S658T probably damaging Het
Tmem174 G T 13: 98,773,433 (GRCm39) H132Q probably damaging Het
Tnfrsf10b G A 14: 70,012,543 (GRCm39) V117I probably benign Het
Tnr A G 1: 159,713,728 (GRCm39) T719A probably benign Het
Tomm34 G A 2: 163,896,379 (GRCm39) P292S probably damaging Het
Trav15-1-dv6-1 T A 14: 53,797,615 (GRCm39) F88Y probably damaging Het
Trp63 A T 16: 25,639,226 (GRCm39) H138L probably damaging Het
U2af2 T A 7: 5,065,290 (GRCm39) S2T probably damaging Het
Uroc1 T C 6: 90,334,510 (GRCm39) V574A possibly damaging Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zfp488 A C 14: 33,692,760 (GRCm39) S134R probably benign Het
Zfp950 T C 19: 61,116,001 (GRCm39) D2G probably benign Het
Zfyve1 T A 12: 83,598,374 (GRCm39) H618L probably damaging Het
Zp1 T G 19: 10,893,888 (GRCm39) D439A probably damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30,401,827 (GRCm39) missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30,401,292 (GRCm39) missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30,410,607 (GRCm39) splice site probably benign
R0042:Adgrf3 UTSW 5 30,402,426 (GRCm39) missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30,401,379 (GRCm39) missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30,400,078 (GRCm39) missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30,401,874 (GRCm39) missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30,404,532 (GRCm39) missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30,400,093 (GRCm39) missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30,407,227 (GRCm39) splice site probably benign
R1695:Adgrf3 UTSW 5 30,408,553 (GRCm39) missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30,402,549 (GRCm39) missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30,404,211 (GRCm39) missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30,407,304 (GRCm39) missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30,407,304 (GRCm39) missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30,404,489 (GRCm39) missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30,401,436 (GRCm39) missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30,401,992 (GRCm39) missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30,401,992 (GRCm39) missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30,402,358 (GRCm39) missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30,405,432 (GRCm39) unclassified probably benign
R4043:Adgrf3 UTSW 5 30,409,360 (GRCm39) missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30,402,367 (GRCm39) nonsense probably null
R4575:Adgrf3 UTSW 5 30,407,255 (GRCm39) missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30,402,615 (GRCm39) critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30,403,442 (GRCm39) missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30,405,476 (GRCm39) missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30,404,146 (GRCm39) missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30,402,304 (GRCm39) missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30,410,637 (GRCm39) missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30,403,360 (GRCm39) critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30,401,265 (GRCm39) missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30,402,531 (GRCm39) missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30,402,312 (GRCm39) missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30,401,522 (GRCm39) missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30,408,601 (GRCm39) missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30,401,385 (GRCm39) missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30,402,519 (GRCm39) missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30,409,378 (GRCm39) nonsense probably null
R7250:Adgrf3 UTSW 5 30,400,680 (GRCm39) missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30,403,495 (GRCm39) missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30,407,245 (GRCm39) missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30,402,204 (GRCm39) missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30,404,510 (GRCm39) missense probably damaging 1.00
R8281:Adgrf3 UTSW 5 30,402,301 (GRCm39) missense possibly damaging 0.46
R8717:Adgrf3 UTSW 5 30,403,579 (GRCm39) unclassified probably benign
R8926:Adgrf3 UTSW 5 30,405,446 (GRCm39) missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30,400,071 (GRCm39) missense possibly damaging 0.94
R9446:Adgrf3 UTSW 5 30,401,957 (GRCm39) missense probably benign 0.01
R9522:Adgrf3 UTSW 5 30,404,482 (GRCm39) missense possibly damaging 0.90
Z1088:Adgrf3 UTSW 5 30,404,118 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGTAAATAGCCAGGCAGACG -3'
(R):5'- GTACTGCAAAAGCTGGACTACC -3'

Sequencing Primer
(F):5'- CAGGCAGACGAGCAAAGCC -3'
(R):5'- TACCGGCTGCCCTCAAAC -3'
Posted On 2021-07-15