Incidental Mutation 'R8857:Tecpr1'
ID675405
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8857 (G1)
Quality Score208.009
Status Not validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144216299 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085701
AA Change: E204G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: E204G

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,130,855 L266F possibly damaging Het
Adgrf3 A T 5: 30,197,067 C654* probably null Het
Adgrl1 C A 8: 83,931,028 A421D probably benign Het
Apba2 T A 7: 64,750,191 V710E possibly damaging Het
Arhgef5 T C 6: 43,287,624 V1523A probably damaging Het
AW551984 G C 9: 39,600,535 A60G probably damaging Het
Bdh1 A T 16: 31,446,632 T42S probably benign Het
C130073F10Rik G A 4: 101,890,358 P158L possibly damaging Het
Cacna2d4 A T 6: 119,271,948 K457* probably null Het
Cd3eap C T 7: 19,359,430 probably benign Het
Chd3 G A 11: 69,362,320 P223L probably benign Het
Cnst T C 1: 179,610,313 S481P probably damaging Het
Col6a3 T A 1: 90,775,763 K3027N unknown Het
Csf2rb2 T C 15: 78,294,413 D111G probably null Het
Disc1 A C 8: 125,165,131 E641A probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Fbln5 C A 12: 101,760,731 C320F probably damaging Het
Fbn2 G A 18: 58,153,861 T242I probably damaging Het
Gpsm1 G C 2: 26,340,445 G469A possibly damaging Het
Hic1 A G 11: 75,165,402 I887T probably benign Het
Hltf T C 3: 20,105,661 V692A probably damaging Het
Hsd17b13 A G 5: 103,977,197 L40P probably damaging Het
Hydin T C 8: 110,571,955 probably null Het
Irf2bpl T C 12: 86,882,585 Y438C possibly damaging Het
Itgb4 A T 11: 115,981,027 N219I probably benign Het
Knop1 T C 7: 118,852,726 K257E Het
Krtap19-5 A T 16: 88,896,251 F58I unknown Het
L3mbtl2 T A 15: 81,687,119 F709L unknown Het
Map1a G A 2: 121,307,617 R2924H probably damaging Het
Mfsd13a A G 19: 46,368,128 D224G probably benign Het
Mme A T 3: 63,348,649 N510I probably damaging Het
Morc2a T A 11: 3,677,484 probably null Het
Mptx2 T C 1: 173,274,885 E79G probably benign Het
Nutm1 A G 2: 112,251,178 M380T probably benign Het
Olfr209 A T 16: 59,361,678 I180N probably damaging Het
Padi4 A G 4: 140,774,161 I7T probably damaging Het
Phf20l1 T C 15: 66,641,932 S1013P probably benign Het
Plb1 T C 5: 32,364,212 V1469A unknown Het
Prkab1 T C 5: 116,020,088 N150D probably damaging Het
Qsox1 A G 1: 155,782,587 V412A possibly damaging Het
Rai1 A G 11: 60,186,567 S486G probably benign Het
Rev3l T A 10: 39,794,969 Y170* probably null Het
Rims2 T A 15: 39,679,648 M1426K possibly damaging Het
Selenoi C A 5: 30,256,162 S132* probably null Het
Shtn1 T C 19: 58,990,368 I498M probably damaging Het
Sin3b T C 8: 72,756,895 M970T probably benign Het
Slc17a8 A G 10: 89,591,160 F360L probably damaging Het
Slc7a11 A G 3: 50,438,856 Y113H probably damaging Het
Spast T A 17: 74,368,943 M327K possibly damaging Het
Sphkap T A 1: 83,280,567 I152F probably damaging Het
Tiam1 A T 16: 89,865,257 S658T probably damaging Het
Tmem174 G T 13: 98,636,925 H132Q probably damaging Het
Tnfrsf10b G A 14: 69,775,094 V117I probably benign Het
Tnr A G 1: 159,886,158 T719A probably benign Het
Tomm34 G A 2: 164,054,459 P292S probably damaging Het
Trav15-1-dv6-1 T A 14: 53,560,158 F88Y probably damaging Het
Trp63 A T 16: 25,820,476 H138L probably damaging Het
U2af2 T A 7: 5,062,291 S2T probably damaging Het
Uroc1 T C 6: 90,357,528 V574A possibly damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp488 A C 14: 33,970,803 S134R probably benign Het
Zfyve1 T A 12: 83,551,600 H618L probably damaging Het
Zp1 T G 19: 10,916,524 D439A probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8926:Tecpr1 UTSW 5 144216962 missense probably damaging 1.00
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCTTCACCATACAAAATCTTGGGC -3'
(R):5'- CTTGCTGAGTGTGGAAGGAC -3'

Sequencing Primer
(F):5'- CTTGGGCAAGATGGTGGTG -3'
(R):5'- CTGAGTGTGGAAGGACTGGAG -3'
Posted On2021-07-15