Incidental Mutation 'R8857:Tecpr1'
ID 675405
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms 2210010N04Rik
MMRRC Submission 068677-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8857 (G1)
Quality Score 208.009
Status Validated
Chromosome 5
Chromosomal Location 144131260-144160433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144153117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000085701
AA Change: E204G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: E204G

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,119,287 (GRCm39) L266F possibly damaging Het
Adgrf3 A T 5: 30,402,065 (GRCm39) C654* probably null Het
Adgrl1 C A 8: 84,657,657 (GRCm39) A421D probably benign Het
Adra1b C G 11: 43,727,092 (GRCm39) probably benign Het
Apba2 T A 7: 64,399,939 (GRCm39) V710E possibly damaging Het
Arhgef5 T C 6: 43,264,558 (GRCm39) V1523A probably damaging Het
AW551984 G C 9: 39,511,831 (GRCm39) A60G probably damaging Het
Bdh1 A T 16: 31,265,450 (GRCm39) T42S probably benign Het
C130073F10Rik G A 4: 101,747,555 (GRCm39) P158L possibly damaging Het
Cacna2d4 A T 6: 119,248,909 (GRCm39) K457* probably null Het
Chd3 G A 11: 69,253,146 (GRCm39) P223L probably benign Het
Cnst T C 1: 179,437,878 (GRCm39) S481P probably damaging Het
Col6a3 T A 1: 90,703,485 (GRCm39) K3027N unknown Het
Csf2rb2 T C 15: 78,178,613 (GRCm39) D111G probably null Het
Disc1 A C 8: 125,891,870 (GRCm39) E641A probably damaging Het
Fbln5 C A 12: 101,726,990 (GRCm39) C320F probably damaging Het
Fbn2 G A 18: 58,286,933 (GRCm39) T242I probably damaging Het
Frem1 T A 4: 82,922,280 (GRCm39) probably benign Het
Gpsm1 G C 2: 26,230,457 (GRCm39) G469A possibly damaging Het
Hic1 A G 11: 75,056,228 (GRCm39) I887T probably benign Het
Hltf T C 3: 20,159,825 (GRCm39) V692A probably damaging Het
Hsd17b13 A G 5: 104,125,063 (GRCm39) L40P probably damaging Het
Hydin T C 8: 111,298,587 (GRCm39) probably null Het
Irf2bpl T C 12: 86,929,359 (GRCm39) Y438C possibly damaging Het
Itgb4 A T 11: 115,871,853 (GRCm39) N219I probably benign Het
Knop1 T C 7: 118,451,949 (GRCm39) K257E Het
Krtap19-5 A T 16: 88,693,139 (GRCm39) F58I unknown Het
L3mbtl2 T A 15: 81,571,320 (GRCm39) F709L unknown Het
Map1a G A 2: 121,138,098 (GRCm39) R2924H probably damaging Het
Mfsd13a A G 19: 46,356,567 (GRCm39) D224G probably benign Het
Mme A T 3: 63,256,070 (GRCm39) N510I probably damaging Het
Morc2a T A 11: 3,627,484 (GRCm39) probably null Het
Mptx2 T C 1: 173,102,452 (GRCm39) E79G probably benign Het
Nutm1 A G 2: 112,081,523 (GRCm39) M380T probably benign Het
Or5ac25 A T 16: 59,182,041 (GRCm39) I180N probably damaging Het
P2rx1 A G 11: 72,903,197 (GRCm39) probably benign Het
Padi4 A G 4: 140,501,472 (GRCm39) I7T probably damaging Het
Phf20l1 T C 15: 66,513,781 (GRCm39) S1013P probably benign Het
Plb1 T C 5: 32,521,556 (GRCm39) V1469A unknown Het
Polr1g C T 7: 19,093,355 (GRCm39) probably benign Het
Prkab1 T C 5: 116,158,147 (GRCm39) N150D probably damaging Het
Qsox1 A G 1: 155,658,333 (GRCm39) V412A possibly damaging Het
Rai1 A G 11: 60,077,393 (GRCm39) S486G probably benign Het
Rev3l T A 10: 39,670,965 (GRCm39) Y170* probably null Het
Rims2 T A 15: 39,543,044 (GRCm39) M1426K possibly damaging Het
Selenoi C A 5: 30,461,160 (GRCm39) S132* probably null Het
Shtn1 T C 19: 58,978,800 (GRCm39) I498M probably damaging Het
Sin3b T C 8: 73,483,523 (GRCm39) M970T probably benign Het
Slc17a8 A G 10: 89,427,022 (GRCm39) F360L probably damaging Het
Slc7a11 A G 3: 50,393,305 (GRCm39) Y113H probably damaging Het
Spast T A 17: 74,675,938 (GRCm39) M327K possibly damaging Het
Sphkap T A 1: 83,258,288 (GRCm39) I152F probably damaging Het
Tiam1 A T 16: 89,662,145 (GRCm39) S658T probably damaging Het
Tmem174 G T 13: 98,773,433 (GRCm39) H132Q probably damaging Het
Tnfrsf10b G A 14: 70,012,543 (GRCm39) V117I probably benign Het
Tnr A G 1: 159,713,728 (GRCm39) T719A probably benign Het
Tomm34 G A 2: 163,896,379 (GRCm39) P292S probably damaging Het
Trav15-1-dv6-1 T A 14: 53,797,615 (GRCm39) F88Y probably damaging Het
Trp63 A T 16: 25,639,226 (GRCm39) H138L probably damaging Het
U2af2 T A 7: 5,065,290 (GRCm39) S2T probably damaging Het
Uroc1 T C 6: 90,334,510 (GRCm39) V574A possibly damaging Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zfp488 A C 14: 33,692,760 (GRCm39) S134R probably benign Het
Zfp950 T C 19: 61,116,001 (GRCm39) D2G probably benign Het
Zfyve1 T A 12: 83,598,374 (GRCm39) H618L probably damaging Het
Zp1 T G 19: 10,893,888 (GRCm39) D439A probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144,145,411 (GRCm39) critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144,148,358 (GRCm39) missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144,153,737 (GRCm39) missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144,134,806 (GRCm39) splice site probably benign
IGL02244:Tecpr1 APN 5 144,146,821 (GRCm39) missense probably benign
IGL02247:Tecpr1 APN 5 144,143,372 (GRCm39) missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144,140,305 (GRCm39) missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144,143,364 (GRCm39) missense probably benign 0.28
larghissimo UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144,150,885 (GRCm39) missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144,147,017 (GRCm39) missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144,134,717 (GRCm39) missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144,155,335 (GRCm39) missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144,144,294 (GRCm39) missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144,132,759 (GRCm39) missense probably benign
R0504:Tecpr1 UTSW 5 144,150,899 (GRCm39) missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144,143,092 (GRCm39) missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144,154,219 (GRCm39) missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144,148,317 (GRCm39) missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144,150,871 (GRCm39) splice site probably null
R0835:Tecpr1 UTSW 5 144,149,410 (GRCm39) missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144,153,747 (GRCm39) missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144,143,357 (GRCm39) missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144,151,128 (GRCm39) missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144,134,762 (GRCm39) missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144,145,426 (GRCm39) missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144,143,347 (GRCm39) missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144,141,515 (GRCm39) missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144,148,274 (GRCm39) missense probably benign 0.10
R2172:Tecpr1 UTSW 5 144,133,235 (GRCm39) missense probably damaging 1.00
R2290:Tecpr1 UTSW 5 144,150,881 (GRCm39) missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144,146,797 (GRCm39) missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144,143,077 (GRCm39) missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144,144,255 (GRCm39) missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144,150,935 (GRCm39) missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144,141,476 (GRCm39) missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144,134,672 (GRCm39) splice site probably null
R5459:Tecpr1 UTSW 5 144,144,234 (GRCm39) missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144,151,162 (GRCm39) missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144,155,451 (GRCm39) nonsense probably null
R5679:Tecpr1 UTSW 5 144,144,241 (GRCm39) missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144,143,364 (GRCm39) missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144,148,239 (GRCm39) missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144,136,009 (GRCm39) missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144,141,458 (GRCm39) missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144,135,394 (GRCm39) missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144,153,776 (GRCm39) missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144,146,792 (GRCm39) missense probably benign
R7276:Tecpr1 UTSW 5 144,153,838 (GRCm39) nonsense probably null
R7314:Tecpr1 UTSW 5 144,154,150 (GRCm39) missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144,145,417 (GRCm39) missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144,155,544 (GRCm39) missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144,140,236 (GRCm39) missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144,135,420 (GRCm39) missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144,137,658 (GRCm39) missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144,150,845 (GRCm39) intron probably benign
R8926:Tecpr1 UTSW 5 144,153,780 (GRCm39) missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144,154,049 (GRCm39) missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144,155,396 (GRCm39) missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144,154,204 (GRCm39) missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144,155,409 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCTTCACCATACAAAATCTTGGGC -3'
(R):5'- CTTGCTGAGTGTGGAAGGAC -3'

Sequencing Primer
(F):5'- CTTGGGCAAGATGGTGGTG -3'
(R):5'- CTGAGTGTGGAAGGACTGGAG -3'
Posted On 2021-07-15