Incidental Mutation 'R8857:Arhgef5'
ID 675406
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8857 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43287624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1523 (V1523A)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: V1523A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: V1523A

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,130,855 L266F possibly damaging Het
Adgrf3 A T 5: 30,197,067 C654* probably null Het
Adgrl1 C A 8: 83,931,028 A421D probably benign Het
Adra1b C G 11: 43,836,265 probably benign Het
Apba2 T A 7: 64,750,191 V710E possibly damaging Het
AW551984 G C 9: 39,600,535 A60G probably damaging Het
Bdh1 A T 16: 31,446,632 T42S probably benign Het
C130073F10Rik G A 4: 101,890,358 P158L possibly damaging Het
Cacna2d4 A T 6: 119,271,948 K457* probably null Het
Cd3eap C T 7: 19,359,430 probably benign Het
Chd3 G A 11: 69,362,320 P223L probably benign Het
Cnst T C 1: 179,610,313 S481P probably damaging Het
Col6a3 T A 1: 90,775,763 K3027N unknown Het
Csf2rb2 T C 15: 78,294,413 D111G probably null Het
Disc1 A C 8: 125,165,131 E641A probably damaging Het
Fbln5 C A 12: 101,760,731 C320F probably damaging Het
Fbn2 G A 18: 58,153,861 T242I probably damaging Het
Frem1 T A 4: 83,004,043 probably benign Het
Gpsm1 G C 2: 26,340,445 G469A possibly damaging Het
Hic1 A G 11: 75,165,402 I887T probably benign Het
Hltf T C 3: 20,105,661 V692A probably damaging Het
Hsd17b13 A G 5: 103,977,197 L40P probably damaging Het
Hydin T C 8: 110,571,955 probably null Het
Irf2bpl T C 12: 86,882,585 Y438C possibly damaging Het
Itgb4 A T 11: 115,981,027 N219I probably benign Het
Knop1 T C 7: 118,852,726 K257E Het
Krtap19-5 A T 16: 88,896,251 F58I unknown Het
L3mbtl2 T A 15: 81,687,119 F709L unknown Het
Map1a G A 2: 121,307,617 R2924H probably damaging Het
Mfsd13a A G 19: 46,368,128 D224G probably benign Het
Mme A T 3: 63,348,649 N510I probably damaging Het
Morc2a T A 11: 3,677,484 probably null Het
Mptx2 T C 1: 173,274,885 E79G probably benign Het
Nutm1 A G 2: 112,251,178 M380T probably benign Het
Olfr209 A T 16: 59,361,678 I180N probably damaging Het
P2rx1 A G 11: 73,012,371 probably benign Het
Padi4 A G 4: 140,774,161 I7T probably damaging Het
Phf20l1 T C 15: 66,641,932 S1013P probably benign Het
Plb1 T C 5: 32,364,212 V1469A unknown Het
Prkab1 T C 5: 116,020,088 N150D probably damaging Het
Qsox1 A G 1: 155,782,587 V412A possibly damaging Het
Rai1 A G 11: 60,186,567 S486G probably benign Het
Rev3l T A 10: 39,794,969 Y170* probably null Het
Rims2 T A 15: 39,679,648 M1426K possibly damaging Het
Selenoi C A 5: 30,256,162 S132* probably null Het
Shtn1 T C 19: 58,990,368 I498M probably damaging Het
Sin3b T C 8: 72,756,895 M970T probably benign Het
Slc17a8 A G 10: 89,591,160 F360L probably damaging Het
Slc7a11 A G 3: 50,438,856 Y113H probably damaging Het
Spast T A 17: 74,368,943 M327K possibly damaging Het
Sphkap T A 1: 83,280,567 I152F probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tiam1 A T 16: 89,865,257 S658T probably damaging Het
Tmem174 G T 13: 98,636,925 H132Q probably damaging Het
Tnfrsf10b G A 14: 69,775,094 V117I probably benign Het
Tnr A G 1: 159,886,158 T719A probably benign Het
Tomm34 G A 2: 164,054,459 P292S probably damaging Het
Trav15-1-dv6-1 T A 14: 53,560,158 F88Y probably damaging Het
Trp63 A T 16: 25,820,476 H138L probably damaging Het
U2af2 T A 7: 5,062,291 S2T probably damaging Het
Uroc1 T C 6: 90,357,528 V574A possibly damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp488 A C 14: 33,970,803 S134R probably benign Het
Zfp950 T C 19: 61,127,563 D2G probably benign Het
Zfyve1 T A 12: 83,551,600 H618L probably damaging Het
Zp1 T G 19: 10,916,524 D439A probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43274802 missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATCCCACACTTGTCTTTACCTCATG -3'
(R):5'- TTGGGGACGAAACTGCTCC -3'

Sequencing Primer
(F):5'- GTCTTTACCTCATGTCCTCCCATAC -3'
(R):5'- AGGCCCTTCCTAGAAGCTTAAGTTG -3'
Posted On 2021-07-15