Incidental Mutation 'R0731:Ahdc1'
ID 67542
Institutional Source Beutler Lab
Gene Symbol Ahdc1
Ensembl Gene ENSMUSG00000037692
Gene Name AT hook, DNA binding motif, containing 1
Synonyms D030015G18Rik
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.189) question?
Stock # R0731 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 132738797-132805421 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 132790262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 501 (V501E)
Ref Sequence ENSEMBL: ENSMUSP00000101536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044521] [ENSMUST00000105914] [ENSMUST00000105915] [ENSMUST00000105916]
AlphaFold Q6PAL7
Predicted Effect possibly damaging
Transcript: ENSMUST00000044521
AA Change: V501E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047113
Gene: ENSMUSG00000037692
AA Change: V501E

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105914
AA Change: V501E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101534
Gene: ENSMUSG00000037692
AA Change: V501E

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
Pfam:DUF4683 559 639 6.4e-15 PFAM
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105915
AA Change: V501E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101535
Gene: ENSMUSG00000037692
AA Change: V501E

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105916
AA Change: V501E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101536
Gene: ENSMUSG00000037692
AA Change: V501E

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156677
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Ahdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ahdc1 APN 4 132,790,373 (GRCm39) missense probably benign 0.33
IGL02293:Ahdc1 APN 4 132,792,929 (GRCm39) missense possibly damaging 0.85
IGL02338:Ahdc1 APN 4 132,789,860 (GRCm39) missense possibly damaging 0.73
IGL02828:Ahdc1 APN 4 132,790,232 (GRCm39) missense possibly damaging 0.96
IGL02859:Ahdc1 APN 4 132,790,004 (GRCm39) missense probably damaging 0.99
IGL02859:Ahdc1 APN 4 132,790,003 (GRCm39) missense possibly damaging 0.53
IGL02901:Ahdc1 APN 4 132,792,245 (GRCm39) missense possibly damaging 0.85
IGL03323:Ahdc1 APN 4 132,792,739 (GRCm39) missense probably benign
FR4304:Ahdc1 UTSW 4 132,790,070 (GRCm39) small insertion probably benign
FR4548:Ahdc1 UTSW 4 132,790,071 (GRCm39) small insertion probably benign
FR4548:Ahdc1 UTSW 4 132,790,068 (GRCm39) small insertion probably benign
FR4737:Ahdc1 UTSW 4 132,790,070 (GRCm39) small insertion probably benign
R0325:Ahdc1 UTSW 4 132,790,030 (GRCm39) missense unknown
R0550:Ahdc1 UTSW 4 132,790,348 (GRCm39) missense probably benign 0.33
R0681:Ahdc1 UTSW 4 132,792,827 (GRCm39) missense possibly damaging 0.53
R0683:Ahdc1 UTSW 4 132,792,827 (GRCm39) missense possibly damaging 0.53
R0751:Ahdc1 UTSW 4 132,792,707 (GRCm39) missense probably benign 0.02
R1137:Ahdc1 UTSW 4 132,789,424 (GRCm39) missense possibly damaging 0.68
R1184:Ahdc1 UTSW 4 132,792,707 (GRCm39) missense probably benign 0.02
R1331:Ahdc1 UTSW 4 132,791,002 (GRCm39) missense probably benign 0.18
R1599:Ahdc1 UTSW 4 132,792,247 (GRCm39) missense possibly damaging 0.91
R2202:Ahdc1 UTSW 4 132,793,220 (GRCm39) missense possibly damaging 0.72
R2205:Ahdc1 UTSW 4 132,793,220 (GRCm39) missense possibly damaging 0.72
R2261:Ahdc1 UTSW 4 132,790,474 (GRCm39) missense unknown
R2262:Ahdc1 UTSW 4 132,790,474 (GRCm39) missense unknown
R3683:Ahdc1 UTSW 4 132,793,013 (GRCm39) missense possibly damaging 0.96
R3684:Ahdc1 UTSW 4 132,793,013 (GRCm39) missense possibly damaging 0.96
R3685:Ahdc1 UTSW 4 132,793,013 (GRCm39) missense possibly damaging 0.96
R3713:Ahdc1 UTSW 4 132,793,297 (GRCm39) missense possibly damaging 0.85
R4027:Ahdc1 UTSW 4 132,791,476 (GRCm39) missense possibly damaging 0.73
R4807:Ahdc1 UTSW 4 132,791,624 (GRCm39) missense possibly damaging 0.86
R4987:Ahdc1 UTSW 4 132,791,631 (GRCm39) missense possibly damaging 0.53
R5126:Ahdc1 UTSW 4 132,790,833 (GRCm39) missense probably benign 0.18
R5276:Ahdc1 UTSW 4 132,790,109 (GRCm39) missense possibly damaging 0.93
R5680:Ahdc1 UTSW 4 132,792,907 (GRCm39) missense probably benign
R5997:Ahdc1 UTSW 4 132,791,206 (GRCm39) missense probably benign 0.05
R6050:Ahdc1 UTSW 4 132,793,202 (GRCm39) missense possibly damaging 0.85
R6271:Ahdc1 UTSW 4 132,792,035 (GRCm39) missense possibly damaging 0.73
R6410:Ahdc1 UTSW 4 132,790,210 (GRCm39) missense probably damaging 0.97
R6519:Ahdc1 UTSW 4 132,792,079 (GRCm39) missense possibly damaging 0.86
R6970:Ahdc1 UTSW 4 132,789,656 (GRCm39) missense possibly damaging 0.96
R7199:Ahdc1 UTSW 4 132,791,935 (GRCm39) missense probably benign 0.33
R7202:Ahdc1 UTSW 4 132,789,198 (GRCm39) nonsense probably null
R7576:Ahdc1 UTSW 4 132,792,313 (GRCm39) missense possibly damaging 0.91
R7614:Ahdc1 UTSW 4 132,790,825 (GRCm39) missense probably benign 0.18
R7794:Ahdc1 UTSW 4 132,791,289 (GRCm39) missense possibly damaging 0.70
R7875:Ahdc1 UTSW 4 132,791,161 (GRCm39) missense possibly damaging 0.53
R8016:Ahdc1 UTSW 4 132,790,226 (GRCm39) missense possibly damaging 0.96
R8295:Ahdc1 UTSW 4 132,788,762 (GRCm39) start codon destroyed probably null 0.53
R8332:Ahdc1 UTSW 4 132,791,282 (GRCm39) missense possibly damaging 0.85
R8719:Ahdc1 UTSW 4 132,791,533 (GRCm39) missense possibly damaging 0.86
R8725:Ahdc1 UTSW 4 132,792,743 (GRCm39) missense possibly damaging 0.86
R8862:Ahdc1 UTSW 4 132,791,129 (GRCm39) missense possibly damaging 0.53
R9158:Ahdc1 UTSW 4 132,792,505 (GRCm39) missense possibly damaging 0.53
R9179:Ahdc1 UTSW 4 132,788,929 (GRCm39) missense possibly damaging 0.93
R9362:Ahdc1 UTSW 4 132,790,348 (GRCm39) missense probably benign 0.33
R9428:Ahdc1 UTSW 4 132,791,773 (GRCm39) missense possibly damaging 0.93
RF017:Ahdc1 UTSW 4 132,790,062 (GRCm39) small insertion probably benign
RF020:Ahdc1 UTSW 4 132,791,588 (GRCm39) missense possibly damaging 0.96
T0722:Ahdc1 UTSW 4 132,790,065 (GRCm39) small insertion probably benign
T0975:Ahdc1 UTSW 4 132,790,065 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTTCTCAAACCCCGATGGTCC -3'
(R):5'- ATTGGCGTCTGCTGCATACGATGG -3'

Sequencing Primer
(F):5'- GGTCCCCACCCGCAAAG -3'
(R):5'- TGTCACAGTAGCAGCCTCAG -3'
Posted On 2013-09-03