Incidental Mutation 'R8857:Shtn1'
ID675447
Institutional Source Beutler Lab
Gene Symbol Shtn1
Ensembl Gene ENSMUSG00000041362
Gene Nameshootin 1
Synonyms4930506M07Rik, shootin1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8857 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location58973358-59076069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58990368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 498 (I498M)
Ref Sequence ENSEMBL: ENSMUSP00000041378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000163821]
Predicted Effect probably damaging
Transcript: ENSMUST00000047511
AA Change: I498M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362
AA Change: I498M

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163821
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,130,855 L266F possibly damaging Het
Adgrf3 A T 5: 30,197,067 C654* probably null Het
Adgrl1 C A 8: 83,931,028 A421D probably benign Het
Apba2 T A 7: 64,750,191 V710E possibly damaging Het
Arhgef5 T C 6: 43,287,624 V1523A probably damaging Het
AW551984 G C 9: 39,600,535 A60G probably damaging Het
Bdh1 A T 16: 31,446,632 T42S probably benign Het
C130073F10Rik G A 4: 101,890,358 P158L possibly damaging Het
Cacna2d4 A T 6: 119,271,948 K457* probably null Het
Cd3eap C T 7: 19,359,430 probably benign Het
Chd3 G A 11: 69,362,320 P223L probably benign Het
Cnst T C 1: 179,610,313 S481P probably damaging Het
Col6a3 T A 1: 90,775,763 K3027N unknown Het
Csf2rb2 T C 15: 78,294,413 D111G probably null Het
Disc1 A C 8: 125,165,131 E641A probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Fbln5 C A 12: 101,760,731 C320F probably damaging Het
Fbn2 G A 18: 58,153,861 T242I probably damaging Het
Gpsm1 G C 2: 26,340,445 G469A possibly damaging Het
Hic1 A G 11: 75,165,402 I887T probably benign Het
Hltf T C 3: 20,105,661 V692A probably damaging Het
Hsd17b13 A G 5: 103,977,197 L40P probably damaging Het
Hydin T C 8: 110,571,955 probably null Het
Irf2bpl T C 12: 86,882,585 Y438C possibly damaging Het
Itgb4 A T 11: 115,981,027 N219I probably benign Het
Knop1 T C 7: 118,852,726 K257E Het
Krtap19-5 A T 16: 88,896,251 F58I unknown Het
L3mbtl2 T A 15: 81,687,119 F709L unknown Het
Map1a G A 2: 121,307,617 R2924H probably damaging Het
Mfsd13a A G 19: 46,368,128 D224G probably benign Het
Mme A T 3: 63,348,649 N510I probably damaging Het
Morc2a T A 11: 3,677,484 probably null Het
Mptx2 T C 1: 173,274,885 E79G probably benign Het
Nutm1 A G 2: 112,251,178 M380T probably benign Het
Olfr209 A T 16: 59,361,678 I180N probably damaging Het
Padi4 A G 4: 140,774,161 I7T probably damaging Het
Phf20l1 T C 15: 66,641,932 S1013P probably benign Het
Plb1 T C 5: 32,364,212 V1469A unknown Het
Prkab1 T C 5: 116,020,088 N150D probably damaging Het
Qsox1 A G 1: 155,782,587 V412A possibly damaging Het
Rai1 A G 11: 60,186,567 S486G probably benign Het
Rev3l T A 10: 39,794,969 Y170* probably null Het
Rims2 T A 15: 39,679,648 M1426K possibly damaging Het
Selenoi C A 5: 30,256,162 S132* probably null Het
Sin3b T C 8: 72,756,895 M970T probably benign Het
Slc17a8 A G 10: 89,591,160 F360L probably damaging Het
Slc7a11 A G 3: 50,438,856 Y113H probably damaging Het
Spast T A 17: 74,368,943 M327K possibly damaging Het
Sphkap T A 1: 83,280,567 I152F probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tiam1 A T 16: 89,865,257 S658T probably damaging Het
Tmem174 G T 13: 98,636,925 H132Q probably damaging Het
Tnfrsf10b G A 14: 69,775,094 V117I probably benign Het
Tnr A G 1: 159,886,158 T719A probably benign Het
Tomm34 G A 2: 164,054,459 P292S probably damaging Het
Trav15-1-dv6-1 T A 14: 53,560,158 F88Y probably damaging Het
Trp63 A T 16: 25,820,476 H138L probably damaging Het
U2af2 T A 7: 5,062,291 S2T probably damaging Het
Uroc1 T C 6: 90,357,528 V574A possibly damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp488 A C 14: 33,970,803 S134R probably benign Het
Zfyve1 T A 12: 83,551,600 H618L probably damaging Het
Zp1 T G 19: 10,916,524 D439A probably damaging Het
Other mutations in Shtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Shtn1 APN 19 59018952 missense possibly damaging 0.56
IGL01619:Shtn1 APN 19 59028169 missense probably damaging 0.99
IGL01880:Shtn1 APN 19 59075449 splice site probably benign
IGL02214:Shtn1 APN 19 58999886 splice site probably benign
IGL03400:Shtn1 APN 19 59032258 splice site probably benign
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0299:Shtn1 UTSW 19 59018951 missense probably benign 0.00
R0606:Shtn1 UTSW 19 58999940 missense probably damaging 0.99
R1081:Shtn1 UTSW 19 58975015 missense probably benign 0.04
R1212:Shtn1 UTSW 19 59050890 missense probably damaging 1.00
R1677:Shtn1 UTSW 19 59009790 missense probably damaging 1.00
R1791:Shtn1 UTSW 19 59032200 missense probably damaging 0.99
R1966:Shtn1 UTSW 19 58975038 missense probably benign
R3076:Shtn1 UTSW 19 58995086 missense probably damaging 1.00
R3552:Shtn1 UTSW 19 58975038 missense probably benign 0.28
R3736:Shtn1 UTSW 19 59022268 missense probably benign
R4615:Shtn1 UTSW 19 59022216 missense probably benign 0.18
R4789:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4791:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4792:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4939:Shtn1 UTSW 19 59022201 missense probably benign 0.00
R5245:Shtn1 UTSW 19 59032220 missense possibly damaging 0.90
R5387:Shtn1 UTSW 19 59038369 missense probably damaging 1.00
R5813:Shtn1 UTSW 19 59032241 missense probably damaging 1.00
R6013:Shtn1 UTSW 19 58975101 missense probably damaging 1.00
R6374:Shtn1 UTSW 19 59038296 missense possibly damaging 0.94
R7030:Shtn1 UTSW 19 59009834 missense possibly damaging 0.74
R7143:Shtn1 UTSW 19 59018906 missense probably damaging 0.99
R7487:Shtn1 UTSW 19 59003860 missense probably damaging 0.99
R7496:Shtn1 UTSW 19 59028184 missense probably damaging 1.00
R7889:Shtn1 UTSW 19 59003896 missense probably damaging 0.99
R8209:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8226:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8290:Shtn1 UTSW 19 58999894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGGGATTCGTGCATCC -3'
(R):5'- ACAATGTCCCAGCATGGTCC -3'

Sequencing Primer
(F):5'- GTGCATCCTTCCAATTTACGGGG -3'
(R):5'- ACCAGCTTGGCCTTTTTG -3'
Posted On2021-07-15