Incidental Mutation 'R0731:Zfp11'
ID67545
Institutional Source Beutler Lab
Gene Symbol Zfp11
Ensembl Gene ENSMUSG00000051034
Gene Namezinc finger protein 11
SynonymsZfp-11, Krox-6
MMRRC Submission 038912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0731 (G1)
Quality Score190
Status Validated
Chromosome5
Chromosomal Location129654593-129670099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129657264 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 378 (S378P)
Ref Sequence ENSEMBL: ENSMUSP00000051861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049778]
Predicted Effect probably damaging
Transcript: ENSMUST00000049778
AA Change: S378P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051861
Gene: ENSMUSG00000051034
AA Change: S378P

DomainStartEndE-ValueType
ZnF_C2H2 57 79 1.03e-2 SMART
ZnF_C2H2 85 107 4.87e-4 SMART
ZnF_C2H2 113 135 2.91e-2 SMART
ZnF_C2H2 141 163 1.1e-2 SMART
ZnF_C2H2 169 191 4.47e-3 SMART
ZnF_C2H2 197 219 6.78e-3 SMART
ZnF_C2H2 225 247 3.39e-3 SMART
ZnF_C2H2 253 275 1.3e-4 SMART
ZnF_C2H2 281 303 8.34e-3 SMART
ZnF_C2H2 309 331 9.08e-4 SMART
ZnF_C2H2 337 359 7.37e-4 SMART
ZnF_C2H2 365 387 4.94e-5 SMART
ZnF_C2H2 393 415 9.58e-3 SMART
ZnF_C2H2 421 443 1.28e-3 SMART
ZnF_C2H2 449 471 6.32e-3 SMART
ZnF_C2H2 477 499 5.5e-3 SMART
ZnF_C2H2 505 527 4.17e-3 SMART
ZnF_C2H2 533 555 3.16e-3 SMART
ZnF_C2H2 561 583 1.45e-2 SMART
ZnF_C2H2 589 611 5.5e-3 SMART
ZnF_C2H2 617 639 1.58e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,586,203 T66A probably damaging Het
4933406M09Rik A C 1: 134,389,975 M162L probably benign Het
Acsm3 A T 7: 119,768,024 R27* probably null Het
Actg1 A G 11: 120,346,949 F255S probably damaging Het
Ahdc1 T A 4: 133,062,951 V501E possibly damaging Het
Alpk2 A T 18: 65,305,390 D1444E probably damaging Het
Btaf1 T G 19: 36,997,495 probably null Het
Cacnb2 A G 2: 14,985,706 H489R possibly damaging Het
Ccdc162 C A 10: 41,579,143 K398N probably damaging Het
Cd79b G T 11: 106,312,433 S145R probably damaging Het
Cdh11 T A 8: 102,668,019 N264Y probably damaging Het
Celsr1 T C 15: 85,901,597 D2892G probably benign Het
Chuk A G 19: 44,103,766 probably benign Het
Clk3 T C 9: 57,751,126 probably benign Het
Dcaf8 A T 1: 172,172,509 D78V possibly damaging Het
Dctn1 A G 6: 83,183,089 T87A probably damaging Het
Ddx50 T C 10: 62,616,249 N732D unknown Het
Dnah5 A T 15: 28,311,143 Y1756F possibly damaging Het
Dock3 A T 9: 106,969,856 V858E probably damaging Het
Fer1l4 A G 2: 156,024,070 F1566S probably benign Het
Fpr-rs7 T C 17: 20,113,854 I125V probably benign Het
Fuca2 C T 10: 13,506,027 P228L probably benign Het
Galntl6 A G 8: 58,535,984 F57L probably benign Het
Gigyf2 T A 1: 87,407,727 probably benign Het
Gm16505 A T 13: 3,361,329 noncoding transcript Het
Gm4781 T C 10: 100,396,777 noncoding transcript Het
Gm9956 T A 10: 56,745,543 Y100* probably null Het
Gpr137c T A 14: 45,246,349 C178S probably damaging Het
Gpr83 A G 9: 14,868,644 R331G probably benign Het
Hlcs T A 16: 94,131,852 H851L probably damaging Het
Kbtbd6 C A 14: 79,451,884 Y6* probably null Het
Kif23 T C 9: 61,925,032 R610G possibly damaging Het
Kifc3 G A 8: 95,105,733 T487I probably damaging Het
Klra5 A C 6: 129,908,796 D133E possibly damaging Het
Klra6 T C 6: 130,022,705 E100G probably damaging Het
Klre1 T A 6: 129,585,568 probably benign Het
Lancl1 C T 1: 67,009,910 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Man1b1 A G 2: 25,338,155 I146V possibly damaging Het
Map4k5 T A 12: 69,874,264 probably benign Het
Mast3 A G 8: 70,781,321 S178P probably damaging Het
Mau2 A G 8: 70,023,612 probably null Het
Mkrn2 A T 6: 115,614,651 N312Y probably damaging Het
Mrvi1 T C 7: 110,876,900 S615G probably benign Het
Myh1 A G 11: 67,202,533 E150G probably damaging Het
Myo7b T A 18: 31,961,825 probably null Het
Nyap1 A G 5: 137,735,298 V491A probably damaging Het
Olfr1284 A G 2: 111,379,293 M98V probably damaging Het
Olfr484 T C 7: 108,124,734 I176M probably benign Het
Olfr518 A T 7: 108,881,533 N24K probably damaging Het
Olfr954 T C 9: 39,461,532 F34L probably damaging Het
Oxsm A T 14: 16,240,893 H385Q probably damaging Het
Pbld2 T C 10: 63,056,811 S242P probably damaging Het
Pdzd7 T C 19: 45,029,305 Y675C probably damaging Het
Pnkd T A 1: 74,351,541 H266Q probably damaging Het
Rbfox2 A G 15: 77,099,279 S141P probably benign Het
Rdx A G 9: 52,068,218 T214A probably benign Het
Ripor2 A T 13: 24,680,644 E219V probably damaging Het
Rufy2 G A 10: 63,011,844 probably benign Het
Slf2 T A 19: 44,975,726 probably benign Het
Snrnp200 G T 2: 127,226,145 probably benign Het
Snx7 T A 3: 117,829,671 probably benign Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Tacr3 G A 3: 134,855,000 probably null Het
Tcerg1 C T 18: 42,571,840 T978M probably damaging Het
Tcf7l1 G T 6: 72,788,269 P126Q possibly damaging Het
Trank1 A G 9: 111,365,488 D860G probably damaging Het
Try4 T C 6: 41,304,367 L81P probably benign Het
Ucp1 T C 8: 83,297,847 probably benign Het
Ugt2b38 G A 5: 87,420,452 A328V probably damaging Het
Wfikkn1 T A 17: 25,878,017 R444S probably damaging Het
Zfc3h1 A G 10: 115,410,632 T875A probably benign Het
Zfp984 T A 4: 147,756,232 N54I probably damaging Het
Other mutations in Zfp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Zfp11 APN 5 129657914 missense probably benign 0.17
R0190:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0239:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0239:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0419:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0423:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0601:Zfp11 UTSW 5 129657907 missense probably damaging 1.00
R0826:Zfp11 UTSW 5 129657525 missense probably benign 0.04
R1467:Zfp11 UTSW 5 129658190 missense probably benign 0.01
R1467:Zfp11 UTSW 5 129658190 missense probably benign 0.01
R1613:Zfp11 UTSW 5 129658367 missense probably benign 0.09
R1711:Zfp11 UTSW 5 129656673 missense probably benign 0.03
R1770:Zfp11 UTSW 5 129657758 missense possibly damaging 0.94
R2155:Zfp11 UTSW 5 129657152 missense probably damaging 1.00
R2369:Zfp11 UTSW 5 129656465 missense probably benign 0.40
R5597:Zfp11 UTSW 5 129657102 missense probably benign 0.08
R5902:Zfp11 UTSW 5 129657912 missense probably damaging 0.98
R6324:Zfp11 UTSW 5 129656523 missense possibly damaging 0.95
R6768:Zfp11 UTSW 5 129658351 missense probably benign 0.05
R6943:Zfp11 UTSW 5 129658088 missense probably damaging 0.99
R7782:Zfp11 UTSW 5 129656963 missense possibly damaging 0.56
R8144:Zfp11 UTSW 5 129656630 missense possibly damaging 0.93
Z1177:Zfp11 UTSW 5 129657032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGAACGGTTTACCACATTCTTTGC -3'
(R):5'- ACCGGAGAAAAGCCCTATCAGTGC -3'

Sequencing Primer
(F):5'- CTGACACTTGTAGGGCTTCT -3'
(R):5'- gccaaaccctacaaatgcc -3'
Posted On2013-09-03