Incidental Mutation 'R8858:A430033K04Rik'
ID675459
Institutional Source Beutler Lab
Gene Symbol A430033K04Rik
Ensembl Gene ENSMUSG00000056014
Gene NameRIKEN cDNA A430033K04 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8858 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138622859-138652414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138640076 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 91 (Q91R)
Ref Sequence ENSEMBL: ENSMUSP00000143566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032590] [ENSMUST00000069862] [ENSMUST00000198958] [ENSMUST00000200521]
Predicted Effect probably benign
Transcript: ENSMUST00000032590
AA Change: Q111R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000032590
Gene: ENSMUSG00000056014
AA Change: Q111R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
KRAB 36 96 6.23e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069862
SMART Domains Protein: ENSMUSP00000067316
Gene: ENSMUSG00000056014

DomainStartEndE-ValueType
KRAB 16 76 6.23e-34 SMART
ZnF_C2H2 261 280 1.01e2 SMART
ZnF_C2H2 455 477 1.47e-3 SMART
ZnF_C2H2 483 505 4.05e-1 SMART
ZnF_C2H2 511 533 5.5e-3 SMART
ZnF_C2H2 539 561 7.26e-3 SMART
ZnF_C2H2 567 589 5.14e-3 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 1.92e-2 SMART
ZnF_C2H2 651 673 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198958
SMART Domains Protein: ENSMUSP00000142904
Gene: ENSMUSG00000056014

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
ZnF_C2H2 261 280 4.2e-1 SMART
ZnF_C2H2 455 477 6.4e-6 SMART
ZnF_C2H2 483 505 1.8e-3 SMART
ZnF_C2H2 511 533 2.3e-5 SMART
ZnF_C2H2 539 561 3e-5 SMART
ZnF_C2H2 567 589 2.1e-5 SMART
ZnF_C2H2 595 617 1.5e-5 SMART
ZnF_C2H2 623 643 2.7e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200521
AA Change: Q91R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143566
Gene: ENSMUSG00000056014
AA Change: Q91R

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G T 7: 120,453,104 C465F probably benign Het
Amfr A G 8: 93,987,442 Y254H probably damaging Het
Arl6ip6 A G 2: 53,203,006 E181G probably damaging Het
Atp10a A G 7: 58,816,223 E1066G probably damaging Het
BC034090 A G 1: 155,226,218 V100A probably benign Het
Cep126 T C 9: 8,130,269 M54V probably benign Het
Csmd1 A G 8: 16,070,304 V1829A probably benign Het
Cyp2c54 G A 19: 40,073,783 T10I probably benign Het
Disc1 A G 8: 125,251,042 Y799C probably damaging Het
Dnajc17 T C 2: 119,180,964 T162A probably benign Het
E330009J07Rik T C 6: 40,422,735 N173S probably benign Het
Fam96a T C 9: 66,132,542 I47T probably damaging Het
Fhad1 T C 4: 141,939,028 E695G possibly damaging Het
Gadl1 A T 9: 116,006,601 S366C probably damaging Het
Gm32742 T A 9: 51,150,956 T691S probably benign Het
Gm8765 T C 13: 50,701,387 S354P probably benign Het
Gsdma3 C A 11: 98,629,869 Q109K probably benign Het
Hsph1 A T 5: 149,625,111 V482E probably damaging Het
Ighv1-23 T A 12: 114,764,463 Y113F probably benign Het
Lactb G T 9: 66,955,900 Y477* probably null Het
Lgr6 T C 1: 134,996,111 probably null Het
Map3k4 A C 17: 12,271,872 L224R probably damaging Het
Mex3d A T 10: 80,381,383 C667S unknown Het
Myh8 A G 11: 67,301,994 E1537G possibly damaging Het
Myo5a T C 9: 75,184,683 S1205P probably damaging Het
Olfr1278 G A 2: 111,293,158 V297M probably benign Het
Olfr171 A G 16: 19,624,359 V247A probably damaging Het
Orc2 A T 1: 58,493,698 D127E probably benign Het
Ppp2r5c T A 12: 110,552,895 probably null Het
Ptpn18 A G 1: 34,463,115 T71A possibly damaging Het
Ralgapa2 C A 2: 146,260,365 probably null Het
Rnase9 G A 14: 51,039,309 P71S Het
Ryr1 A G 7: 29,109,213 L485P probably benign Het
Sardh T C 2: 27,228,290 D476G probably null Het
Sorbs3 T C 14: 70,201,401 Y170C probably damaging Het
St8sia5 C T 18: 77,232,815 P88S probably benign Het
Tmprss15 A G 16: 79,057,609 probably null Het
Tnfrsf13b A G 11: 61,147,537 I215M possibly damaging Het
Unc13d G T 11: 116,062,792 L1052M probably damaging Het
Vasn A G 16: 4,648,969 D260G probably benign Het
Wdr77 T C 3: 105,961,662 V116A probably damaging Het
Zfp560 A G 9: 20,349,107 I153T probably benign Het
Zfp672 G A 11: 58,317,319 R59C possibly damaging Het
Other mutations in A430033K04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:A430033K04Rik APN 5 138647592 missense probably damaging 1.00
IGL00336:A430033K04Rik APN 5 138647104 missense probably damaging 0.99
IGL02615:A430033K04Rik APN 5 138646140 nonsense probably null
IGL03354:A430033K04Rik APN 5 138646779 missense possibly damaging 0.85
R0172:A430033K04Rik UTSW 5 138647316 missense probably damaging 0.99
R1769:A430033K04Rik UTSW 5 138646257 missense probably benign 0.04
R4515:A430033K04Rik UTSW 5 138647744 missense probably damaging 1.00
R4903:A430033K04Rik UTSW 5 138646857 nonsense probably null
R4964:A430033K04Rik UTSW 5 138646857 nonsense probably null
R5389:A430033K04Rik UTSW 5 138646297 missense probably benign 0.02
R5769:A430033K04Rik UTSW 5 138646333 missense possibly damaging 0.86
R6128:A430033K04Rik UTSW 5 138647776 missense probably damaging 1.00
R6399:A430033K04Rik UTSW 5 138647559 missense probably damaging 1.00
R6444:A430033K04Rik UTSW 5 138639569 small deletion probably benign
R6600:A430033K04Rik UTSW 5 138647448 frame shift probably null
R6774:A430033K04Rik UTSW 5 138646450 missense probably benign
R7098:A430033K04Rik UTSW 5 138646522 missense probably benign
R7217:A430033K04Rik UTSW 5 138646926 missense probably benign
R7269:A430033K04Rik UTSW 5 138646752 missense possibly damaging 0.86
R7429:A430033K04Rik UTSW 5 138636183 missense possibly damaging 0.92
R7442:A430033K04Rik UTSW 5 138647247 missense possibly damaging 0.55
R7718:A430033K04Rik UTSW 5 138647860 missense possibly damaging 0.73
R8007:A430033K04Rik UTSW 5 138646639 missense probably benign 0.33
R8170:A430033K04Rik UTSW 5 138647053 missense possibly damaging 0.72
R8348:A430033K04Rik UTSW 5 138636252 missense probably damaging 1.00
R8496:A430033K04Rik UTSW 5 138646858 missense probably benign 0.00
R8520:A430033K04Rik UTSW 5 138646706 missense possibly damaging 0.72
R8778:A430033K04Rik UTSW 5 138646887 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGACTGGGTTGGCTGATAAATTAGAC -3'
(R):5'- AGACAGCAACCTATATGGCAAG -3'

Sequencing Primer
(F):5'- ACTCAATCTGTAGACCAGGCTGG -3'
(R):5'- GCAACCTATATGGCAAGAACTAAC -3'
Posted On2021-07-15